Amniotic fluid derived cells
专利摘要:
公开号:AU2006202209A1 申请号:U2006202209 申请日:2006-05-25 公开日:2006-12-14 发明作者:Alireza Rezania;Jean Xu 申请人:LifeScan Inc; IPC主号:A61K35-50
专利说明:
P/00/011 Regulation 3.2 AUSTRALIA Patents Act 1990 COMPLETE SPECIFICATION FOR A STANDARD PATENT ORIGINAL TO BE COMPLETED BY APPLICANT Name of Applicant: LIFESCAN, INC. Actual Inventors: Alireza Rezania Jean Xu Address for Service: CALLINAN LAWRIE, 711 High Street, Kew, Victoria 3101, Australia Invention Title: AMNIOTIC FLUID DERIVED CELLS The following statement is a full description of this invention, including the best method of performing it known to us:- 24/05/06,15735 Cover gp,1 AMNIOTIC FLUID DERIVED CELLS Related US application data Provisional application No 60/685,607, filed t 05/27/2005. Provisional application No 60/743,821, filed 03/27/2006. FIELD OF THE INVENTION C This invention relates to an expandable population of amniotic fluid-derived cells that can be differentiated into a P-cell lineage. This invention also provides methods IND for isolating and expanding such amniotic fluid-derived cells, as well as related Smethods and compositions for utilizing such cells in the therapeutic treatment of diabetes. BACKGROUND Loss of organ function can result from congenital defects, injury or disease. One example of a disease causing loss of organ function is diabetes mellitus, or diabetes. Most cases of diabetes fall into two clinical types: Type 1, also known as juvenileonset diabetes, or insulin dependent diabetes mellitus (IDDM), and Type 2, also known as adult-onset diabetes. Each type has a different prognosis, treatment, and cause. Both types are characterized by the patient's inability to regulate their blood glucose levels. As a consequence, blood glucose levels rise to high values because glucose cannot enter cells to meet metabolic demands. This inability to properly metabolize blood sugar causes a complex series of early and late-stage symptomologies, beginning with, for example, hyperglycemia, abnormal hunger, thirst, polyuria, and glycouria, and then escalating to, for example, neuropathy, macro-vascular disease, and micro-vascular disease. A common method of treatment of Type 1 diabetes involves the exogenous administration of insulin, typically by injection with either a syringe or a pump. This method does not completely normalize blood glucose levels and is often associated with an increased risk of hypoglycemia. More effective glycemic control can be achieved if the function of the pancreas can be restored or rejuvenated via transplantation or cell-based therapies. 24/05/06,15735 speci gp,2 -3- There are many transplantation therapies currently used to treat diabetes: One such treatment involves transplanting isolated islets of Langerhans into the diabetic patient. One of the main hurdles to human islet transplantation has been the lack of sufficient number of islets to treat the large number of diabetic patients. One possible solution to the shortage of islets is the generation of islets from alternate cellular sources. It has been documented that progenitor cells derived from adult tissues are capable of differentiation into a pancreatic 0-cell phenotype. See, for example, WO2004/087885 A2, Hess et al. (Nature Biotechnology 21, 763 770, 2003), and lanus et al. Clin. Invest. 111: 843-850, 2003), which report the capacity of adult bone marrow-derived cells (mesenchymal and hematopoetic cells) to differentiate into cells having characteristics of a pancreatic p-cell in vitro, or secrete trophic factors that help regenerate a damaged pancreas in vivo. Among other sources of progenitor cells that can be differentiated into pancreatic cells include rodent liver oval stem cells (W003/033697) and post-partum placenta (U.S. Published Application 2004/0161419 Al). The endocrine cells of the islets of Langerhans, including p-cells, are constantly turning over by processes of apoptosis and the proliferation of new islet cells (neogenesis). As such, the pancreas is thought to be a source of progenitor cells that are capable of differentiating into pancreatic hormone producing cells. There are three distinct tissue types, isolated from a pancreas, that are a potential source of pancreatic progenitor cells: an islet rich fraction, a ductal cell rich fraction, and an acinar cell rich fraction. Isolation of progenitor cells or partially differentiated cells from crude pancreatic tissue extracts may be achieved using antibodies raised against cell surface markers. For example, U.S. Published Application 2004/0241761 discloses isolation of murine cells that expressed ErbB2, ErbB3, ErbB4, Msx-2, PDX-1 and insulin. Gershengom et al. (Science 306: 2261-2264, 2004) teach the production of proliferating cells that were able to form islet-like cell aggregates. The cells were derived from a heterogeneous population of adherent cells that emerged from the 24/05/06,15735 speci gp,3 N0 culture of isolated human pancreatic islets in vitro. The isolated islets of Langerhans O 0 were initially seeded onto tissue culture dishes and cultured in medium containing (N serum. Fibroblast-like cells were observed to migrate out of the cultured islets Sand form a monolayer. These cells expressed Nestin, smooth muscle actin and tn 5 vimentin. Pancreatic progenitor cells may also arise from the culture of pancreatic islet and ductal tissue that has been dissociated into single cells, as disclosed by Seaberg et al. (Nature Biotechnology 22: 1115 1124, 2004). The murine progenitor cells disclosed by Seaberg et al. expressed Nestin during proliferation. U.S. Published Application 2003/0082155 discloses methods to isolate and identify a population of cells from the islets of Langerhans of human pancreas, which have the functional and molecular characteristics of stem cells. In particular, these cells were characterized by Nestin-positive staining, Nestin gene expression, GLP-1R-positive staining, GLP- 1R gene expression, ABCG2 positive staining, ABCG2 gene expression, Oct3/4 positive staining, Oct3/4 gene expression, latrophilin (type 2) positive staining, latrophilin (type 2) gene expression, Hes-1 positive staining, Hes-1 gene expression, Integrin subunits a6 and pi positive staining, Integrin subunits a6 and pl gene expression, c-kit positive staining, c-kit gene expression, MDR-1 positive staining, MDR-1 gene expression, SST-R, 2, 3, 4 positive staining, SST-R, 2, 3, 4 gene expression, SUR-1 positive staining, SUR-1 gene expression, Kir 6.2 positive staining, Kir 6.2 gene expression, CD34 negative staining, CD45 negative staining, CD133 negative staining, MHC class I negative staining, MHC class II negative staining, cytokeratin-19 negative staining, long-term proliferation in culture, and the ability to differentiate into pseudo-islets in culture. In another approach, as disclosed in U.S. Patent 5,834,308, U.S. Patent 6,001,647 and U.S. Patent 6,703,017, crude preparations of islet cultures from NOD mice may be used to establish epithelial-like cultures, which can be maintained in growing cultures for greater than 1 year and which appear to demonstrate the ability to differentiate into islet-like clusters, capable of secreting insulin. 24/05/06,15735 speci gp. 4 Islet-like structures may be generated from fractions of digested human pancreata enriched for ductal tissue, as disclosed in Bonner-Weir et al. (Proc Nat Acad Sci 97: 7999-8004, 2000) and U.S. Patent 6,815,203 B1. Islet-like clusters disclosed in these publications stained positive for cytokeratin-19 and showed immunoreactivity for insulin. W02004/011621 discloses the generation of insulin negative adherent cells from human pancreatic ductal fragments. W003/102134 discloses the generation of an epithelial cell positive for cytokeratin- 19 from an acinar fraction of a human pancreatic digest. The cells generated are capable of limited expansion and differentiate into an insulin-producing cell in the presence of an induction media. U.S. Published Application 2004/015805 Al reports that a subset of human pancreatic stem cells may be isolated using ligands to the cell surface marker CD56 (also known as NCAM). These cells can differentiate into insulin producing cells and insulin producing aggregates. It has been documented that progenitor cells, derived from fetal or embryonic tissues, have the potential to differentiate into a pancreatic hormone-producing cell. See, for example, U.S. Patent 6,436,704, W003/062405, W002/092756 and EP 0 363 125 A2, which report the potential of human fetal and embryonic derived cells to differentiate into a p-cell lineage. Human Embryonic Stem cells (hES) are derived from the inner cell mass of the blastocyst, the earliest stage of embryonic development of the fertilized egg. The blastocyst is a pre-implantation stage of the embryo, a stage before the embryo would implant in the uterine wall. When cultured on an inactivated feeder layer of cells according to conditions described by Thompson and colleagues (Thomson, et al. (Proc. Natl. Acad Sci. U.S.A. 92: 7844-7848, 1995); Thomson, et al. (Science 282:1145-1147, 1998), Marshall, et al., (Methods Mol. Biol. 158:11-18, 2001), the inner layer cells of the blastocyst may be grown in vitro indefinitely in an undifferentiated state. Properly propagated hES cells have unlimited potential to double while maintaining their pluiripotency; namely their capacity of differentiating into the three layers of the 24/05/06,15735 speci embryo, Ectoderm Mesoderm (Me) and Endoderm When grown as pluripotent hES, the cells maintain a euploid karyotype and are not prone to senescence. Human embryonic stem cells display a distinct group of cell surface antigens, SSEA-3, SSEA-4, TRA-2-54 (alkaline phosphatase), TRA-1-60 and TRA-1-81, in addition to expressing specific transcription factors OCT-4, NANOG, SOX-2, FGF-4 and REX-1 (Henderson, et al., (Stem Cells 20:329-337, 2002), Draper, et al., Anat. 200:249-258, 2002), Mitsui et al., (Cell 113:631-642, 2003), Chambers et al., (Cell 113:643-655, 2003). It is important to note from these publications, however, that human embryonic cells often require a feeder layer for expansion and maintenance of pluripotency or combination of a complex extracellular matrix, such as, for example, MATRIGELTM, plus conditioned media. These conditions do not allow the facile scale up of cells and an eventual cell therapy for treating diabetes. Researchers have found that non-embryonic types of stem cells ("adult stem cells") are not as capable of differentiating into many different tissue types, as are embryonic stem cells, so embryonic stem cells still have many advantages over the use of adult stem cells. However, one obstacle with the isolation of embryonic stem cells is that the cells are derived from embryos at the "blastocyst" stage. Human embryonic stem cell research is encumbered by an emotionally charged political and ethics debate and is likely to remain so for years to come. Additionally, human embryonic stem cells (hES) have been found to be tumorigenic when injected into immunologically impaired animals, i.e. in the context of postnatal tissues, whereas adult stem cells are not. The tumorigenic attributes of hES cells are not frequently addressed, though this issue may burden their use in replacement cell therapy in the future. The political, moral and ethical issues around hES cells and their tumorigenic properties, as well as the perceived difficulties of expanding undifferentiated adult stem cells in culture, while maintaining a genetically normal genome, are major barriers in the development of human cell replacement therapy. 24/05/06,15735 speci gp,6 Pluripotent or multipotent stem cells have been isolated from chorionic villus, and amniotic fluid. Many amniotic and placental cells share a common origin, namely the inner cell mass of the morula, which gives rise to the embryo itself, the yolk sac, the mesenchymal core of the chorionic villi, the chorion and the amnion (Crane Cheung, Prenatal Diagnosis 8: 119-129, 1988). Embryonic and fetal cells from all three germ layers have long been identified in the amniotic fluid (Milunsky, Genetic Disorder of the Fetus. New York: Plenum Press, 75-84, 1979; Hoehn Salk, Methods in Cell Biology 26, 11-34, 1982; Gosden, British Medical Bulletin 39, 348- 354, 1983; Prusa et al, Human Reproduction 18, 1489-1493, 2003). Thus, amniotic fluid may provide the least invasive access to embryonic-like and fetal-like stem cells. Amniotic fluid derived cells have been routinely used for detecting chromosomal abnormality of the fetus. Amniotic fluid is typically sampled during the 2nd trimester (16 to 22 weeks of gestation). Previous art clearly demonstrates presence of three sub-population with distinct cell morphologies: "fibroblastic" "amniotic fluid" (AF) cells, and "epithelial" cells. The F and AF cells rapidly expand whereas the E cells display a much slower growth curve and have poor clonal efficiency. For example, PCT application W02003/042405 discloses isolation of c-Kit positive stem cells from chorionic villus, amniotic fluid and placenta (Cell 1, Table I). In another example, U.S. Published Application 2005/0054093 discloses the isolation of stem cells from amniotic fluid. These cells express stage-specific embryonic antigen 3 (SSEA3), stage-specific embryonic antigen 4 (SSEA4), Tral-60, Tral-81, Tra2-54, Oct-4, HLA class I, CD13, CD44 CD49b and CD105 (Cell 2, Table I). In another example, fetal cells have been isolated from amniotic fluid (in't Anker et al, Blood 102, 1548-1549, 2003). The cells disclosed were positive for expression of the following markers: CD44, CD73, CD90, CD105, CD106, HLA-A,B, C. The cells were negative for expression of the following markers: c-Kit (CD117), CD11, CD31, CD34, CD45 and HLA-D (Cell 3, Table I). 24/05/06,15735 speci gp.7 -8- A population ofmesenchymal stem cells isolated from amniotic fluid has also been reported in a publication to Tsai et al (Tsai et al, Human Reproduction 19, 1450-1456, 2004). The cells disclosed were positive for expression of the following markers: CD29, CD44, CD73, CD90, HLA-A,B, C. The cells were also positive for the embryonic transcription factor Oct-4. The cells were negative for expression of the following markers: c-Kit (CD117), CD34 and HLA-D (Cell 4, Table I). Although recent publications and patents have suggested that within the fibroblastic, amniotic fluid, or epithelial subpopulations there exists a cell population that display some characteristics of human embryonic cells, such as expression of surface markers SSEA3 and expression of transcription factor Oct-4, strong expansion potential, and differentiation into multiple cell types; none of the previously published art has demonstrated the existence of a subpopulation of the cells that display expression of key early endodermal markers, such as HNF-1 beta, HNF-3 beta, SOX-17, and GATA-6, while maintaining expression of ES markers SSEA-4. Co expression of HNF-1 beta, HNF-3 beta (also known as FOXa2), SOX-17, and GATA-6 is regarded as the key step to define the formation of definitive endoderm during gastrulation. Thus, expression of these markers may be key in the generation of a pancreatic p-cell population, or a population of pancreatic hormone-producing cells, or a gut hormone-producing cell from an amniotic fluid-derived cell. Therefore, there still remains a significant need to develop culture conditions for establishing amniotic fluid-derived cell lines that can be expanded to address the current clinical needs, while retaining the potential to differentiate into definitive endoderm, or a population of pancreatic hormone-producing cells, or a gut hormone-producing cell, or a p-cell lineage. SUMMARY In one embodiment, the present invention provides a method for isolating mammalian amniotic fluid-derived cells. According to the present invention, amniotic fluid-derived cells are obtained from amniotic fluid samples of about 14 to about 23 weeks gestation. Alternatively, the amniotic fluid-derived cells are obtained from amniotic fluid samples of about 23 to about 40 weeks gestation. 24/05/06,15735 speci gp.8 SIn one embodiment, the cultures are left undisturbed for at least 5 to 10 days under Shypoxic conditions 02). Alternatively, the cultures are left undisturbed for at least 5 to 10 days under normoxic conditions (approximately 20% 02). In an alternate embodiment, amniotic fluid-derived cells are obtained from amniotic fluid samples from the second trimester of gestation. Alternatively, the amniotic fluid-derived cells are obtained from amniotic fluid samples from the third trimester of gestation. In one embodiment, the cultured amniotic fluid-derived cells are isolated as single Scells, and clonally expanded. 10 The amniotic fluid-derived isolated according to the methods of the present invention can be contacted, for example, with an agent (such as an antibody) that specifically recognizes a protein marker expressed by amniotic fluid cells, to identify and select amniotic fluid-derived cells, thereby obtaining a substantially pure population of amniotic fluid-derived cells, wherein a recognized protein marker is expressed in at least 50% of the cell population. In one embodiment, the resulting amniotic fluid-derived cell population is substantially positive for at least one of the following markers: HNF-1 beta, HNF-3 beta, SOX-I 7, or GATA-6. The amniotic fluid-derived cell population is substantially negative for at least one of the following markers: CD 17, Oct-4, or Tra2-54. The amniotic fluid-derived cell population can be expanded for more than population doublings without losing the capacity to express HNF-1 beta, HNF-3 beta, SOX-17, or GATA-6. In one embodiment, the amniotic fluid-derived cell population is substantially positive for the following markers: SSEA4 and CD44. The amniotic fluid-derived cell population can be expanded for more than 50 population doublings without losing the capacity to express HNF- 1 beta, HNF-3 beta, SOX-17, or GATA-6. In one embodiment, the amniotic fluid-derived cell population isolated according to the methods of the present invention is substantially negative for at least one of the following markers: SOX-17, CD 17, Oct-4, or Tra2-54. The amniotic fluid-derived 24/05/06,15735 spci gp,9 cell population is substantially positive for the following markers: SSEA4 and CD44. The amniotic fluid-derived cell population can be expanded for more than population doublings. In one embodiment, the amniotic fluid-derived cell population isolated according to the methods of the present invention is substantially negative for cytokeratin and at least one of the following markers: SOX-17, CD117, Oct-4, or Tra2-54. The amniotic fluid-derived cell population is substantially positive for the following markers: SSEA4 and CD44. The amniotic fluid-derived cell population can be expanded for more than 50 population doublings. In one embodiment, the amniotic fluid-derived cell population isolated according to the methods of the present invention is substantially negative for SOX-17. The amniotic fluid-derived cell population is substantially positive for the following markers: SSEA4 and CD44. The amniotic fluid-derived cell population can be expanded for more than 50 population doublings. In one embodiment, the amniotic fluid-derived cell population isolated according to the methods of the present invention is substantially negative for the following markers: cytokeratin, and SOX-17. The amniotic fluid-derived cell population is substantially positive for the following markers: SSEA4 and CD44. The amniotic fluid-derived cell population can be expanded for more than 50 population doublings. In one embodiment, the amniotic fluid-derived cell population isolated according to the methods of the present invention is substantially negative for SOX-17. The amniotic fluid-derived cell population is further negative for at least one of the following markers: CD117, Oct-4, or Tra2-54. The amniotic fluid-derived cell population is substantially positive for the following markers: SSEA4 and CD44. The amniotic fluid-derived cell population can be expanded for more than population doublings. In one embodiment, the amniotic fluid-derived cell population isolated according to the methods of the present invention is substantially negative for the following markers: cytokeratin, and SOX-17. The amniotic fluid-derived cell population is 24/05/06.15735 speci gp. -11further negative for at least one of the following markers: CD 17, Oct-4, or Tra2-54. SThe amniotic fluid-derived cell population is substantially positive for the following markers: SSEA4 and CD44. The amniotic fluid-derived cell population can be expanded for more than 50 population doublings. C 5 In another embodiment, the present invention provides an isolated pure population of amniotic fluid-derived cells that are substantially negative for at least one of the following markers: CD 117, Oct-4, or Tra2-54. In another embodiment, the present invention provides an isolated pure population of INO amniotic fluid-derived cells that are substantially negative for at least one of the 0 following markers: SOX-17, CD 117, Oct-4, or Tra2-54. In another embodiment, the present invention provides an isolated pure population of amniotic fluid-derived cells that are substantially negative for SOX-17. In another embodiment, the present invention provides an isolated pure population of amniotic fluid-derived cells that are substantially negative for SOX-17, and substantially negative for at least one of the following markers: CD1 17, Oct-4, or Tra2-54. In one embodiment, the amniotic fluid-derived cells isolated according to the methods of the present invention may also express at least one of the following: Musashi- 1 and Hesl. The amniotic fluid-derived cells isolated and expanded according to the present invention can be induced to differentiate into cells of the 13 cell lineage under appropriate in vitro or in vivo conditions. Accordingly, the amniotic fluid-derived cells selected and expanded according to the present invention, as well as the differentiated cells derived from the amniotic fluid-derived cells, are useful for treating Type 1 and 2 diabetes. The amniotic fluid-derived cells isolated and expanded according to the present invention can be induced to gut hormone-producing cells under appropriate in vitro or in vivo conditions. In one embodiment, the amniotic fluid-derived cells isolated and expanded according to the present invention can be induced to gut hormone- 24/05/06,15735 speci gp.I I -12producing cells under appropriate in vitro or in vivo conditions and may express insulin in a glucose responsive manner. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the isolation and culturing steps used to isolate the amniotic fluid derived cells of the present invention. Figure 2 shows three distinct morphologies of cells isolated from an amniotic fluid sample at passage 0. a) AF morphology, b) epithelial morphology, and c) fibroblast morphology. Figure 3 depicts the expression of cell surface markers on AF-I cells derived from amniotic fluid. The markers are indicated on panels a-n. Figure 4 depicts the expression of cell surface markers on F cells derived from amniotic fluid. The markers are indicated on panels a-1. Figure 5 depicts the expression of cell surface markers on E cells derived from amniotic fluid. The markers are indicated on panels a-m. Figure 6 depicts immunofluoresence images of the F cells derived from amniotic fluid samples. F cells stained positive for a) vimentin, b) SSEA-4, and c) beta III tubulin. Figure 7 depicts immunofluoresence images of the E cells derived from amniotic fluid samples. E cells stained positive for a) vimentin and nestin, b) SSEA-4, c) beta III tubulin, d) pan-cytokeratin, e) smooth muscle actin, and f) cytokeratin 19. Figure 8 depicts immunofluoresence images of the AF-I cells derived from amniotic fluid samples. AF-I cells stained positive for a) vimentin and nestin, b) beta III tubulin, c) cytokeratin 19 and HES-1, d) pan-cytokeratin, e) SSEA-4, f) SOX-17 and ZO-1, g) GATA-6, h) HNF-1 beta, i) smooth muscle actin and HES-2. Figure 9 shows the expression profile of AF-I, AF-II, and AF-III cells of the present invention. Figure 10 depicts the population doubling curve of early passage AF-I cells. 24/05/06,15735 speci gp 12 13- Figure 11 depicts the expansion potential of AF, F, or E cell derived from different donors. shows the cell number of amniotic fluid-derived cells with AF-I morphology obtained from amniotic fluid from one donor at 14-23 weeks gestation. Cells were cultured in media number 5 (Table II). A shows the cell number of amniotic fluid-derived cells with AF-I morphology obtained from amniotic fluid from a second donor at 14-23 weeks gestation. Cells were cultured in media number (Table II). N shows the cell number of amniotic fluid-derived cells with F morphology obtained from amniotic fluid from a third donor at 14-23 weeks gestation. Cells were cultured in media number 15 (Table II). shows the cell number of amniotic fluid-derived cells with F morphology obtained from amniotic fluid from a fourth donor at 14-23 weeks gestation. Cells were cultured in media number 16 (Table II). 0 shows the cell number of amniotic fluid-derived cells with E morphology obtained from amniotic fluid from a donor at 14-23 weeks gestation. Cells were cultured in media number 5. shows the cell number of amniotic fluidderived cells with AF-II morphology obtained from amniotic fluid from a second donor at 14-23 weeks gestation. Cells were cultured in media number 5 (Table II). A shows the cell number of amniotic fluid-derived cells with AF-III morphology obtained from amniotic fluid from a second donor at 14-23 weeks gestation. Cells were cultured in media number 5 (Table II) Figure 12 depicts the telomere length of an AF-I cell line cultured either in AMNIOMAX or DM-LG 10 FBS at an intermediate passage level (approximately 40 population doublings). Lane 1 is the molecular weight ladder, lane 2 is the high telomere length control, lane 3 is the low telomere length control, lane 4 is amniotic fluid-derived cells from a donor at Passage 12, cultured in DMEM- LG 10% FBS, lane 5 is amniotic fluid-derived cells from the same donor at passage 12, cultured in media and lane 6 is an embryonic carcinoma cell line (NTERA cells) that serves as a positive control. Figure 13 shows the karyotype of a) AF-I, b) AF-II, and c) AF-III cells cultured at passage 7-9 (approximately 30-35 population doublings). 24/05/06,15735 speci gp.13 -14- Figure 14 depicts the expansion potential of a single AF derived cell from one donor at term (approximately 38 weeks). Cells were cultured in media number 5 (Table II). Figure 15 depicts the scatter plot gene expression profiles between the different amniotic fluid cell types. The Pearson correlation coefficient for each plot is also listed. Figure 16 shows the effects of growth factors on gene expression in amniotic fluidderived cells. Amniotic fluid-derived cells were obtained from a single donor and cultured for 12 days in conditioned media that was obtained from cultures of PANC- 1 cells. The media was supplemented with the growth factors indicated. The levels of expression of HNF-3 beta and somatostatin were determined by real-time PCR. Human pancreas total RNA was included as a calibrator. Panel a shows the changes in HNF-3 beta expression. Panel b shows the changes in somatostatin expression. Figure 17 shows the effects of L685,458 on cultured amniotic fluid-derived cells having the AF morphology. Panel a shows the relative differences in RNA expression of human Hes-1 in cultured AF cells treated with the concentrations of L685,458 indicated. Panel b shows the effects of L685,458 on the viability of the cultured cells following a treatment with L685,458. Cells were treated for three days, at the concentrations indicated. Changes in viability, corresponding to cytotoxicity were detected using an MTS assay, where a decrease in cell viability corresponds to a decrease in A490nm. DETAILED DESCRIPTION For clarity of disclosure, and not by way of limitation, the detailed description of the invention is divided into the following subsections that describe or illustrate certain features, embodiments or applications of the present invention. The present invention is directed to methods for isolating an amniotic fluid-derived cell population that is highly proliferative, and displays embryonic-like characteristics. Similar cells may also be present in the chorionic villus. Some of the embodiments of the invention disclosed herein describe three morphologically distinct populations of 24/05/06,15735 speci gp, 14 amniotic fluid-derived cells: "fibroblastic" epithelial" cells, and "amniotic fluid" (AF) cells. Definitions "p-cell lineage" refer to cells with positive gene expression for the transcription factor PDX-1 and at least one of the following transcription factors: NGN-3, Nkx2.2, Nkx6.1, NeuroD, Isl-1, HNF-3 beta, MAFA, Pax4, and Pax6. Characteristics of cells of the beta cell lineage are well known to those skilled in the art, and additional characteristics of the beta cell lineage continue to be identified. These transcription factors are well established in prior art for identification of endocrine cells (Nature Reviews Genetics, Vo13, 524-632, 2002). "Pancreatic islet-like structure" refers to a three-dimensional clusters of cells derived by practicing the methods of the invention, which has the appearance of a pancreatic islet. The cells in a pancreatic islet-like structure express at least the PDX-1 gene and one hormone selected from the list glucagon, somatostatin, or insulin. The term "hypoxic" refers to oxygen levels less than 20%, preferably less than and more preferably less than 5% but more than 1%. The term "normoxia" refers to atmospheric oxygen levels of about The term "substantially positive," when used in connection with a population of cells with respect to the expression of certain marker (such as a membrane receptor, cytoplasmic or nuclear protein, or a transcription factor), means that the marker is present or expressed in at least about 50%, alternatively at least about 60%, and alternatively at least about 70%, of the total cell population. The term "substantially negative," when used in connection with a population of cells with respect to the expression of certain marker (such as a membrane receptor, cytoplasmic or nuclear protein, or a transcription factor), means that the marker is not present or expressed in at least about 70%, alternatively about 80%, alternatively about 90%, of the total cell population. 24/05/06.15735 speci gp, -16- O A "stem cell" as used herein refers to an undifferentiated cell that is capable of O extensive propagation either in vivo or ex vivo and capable of differentiation to other cell types. A "progenitor cell" refers to a cell that is derived from a stem cell by differentiation and is capable of further differentiation to more mature cell types. Progenitor cells typically have more restricted proliferation capacity as compared to stem cells. S"Expandable population" refers to the ability of an isolated cell population to be propagated through at least 50 or more cell divisions in a cell culture system. IBy "undifferentiated cells," when used in connection with cells isolated from a amniotic fluid, are meant a population of amniotic fluid-derived cells that are substantially negative for the expression of PDX- 1, or insulin. By "differentiated cells," when used in connection with cells isolated from amniotic fluid, are meant a population of amniotic fluid-derived cells that are substantially positive for the expression of PDX-1, or insulin. "Markers" as used herein, are nucleic acid or polypeptide molecules that are differentially expressed in a cell of interest. In this context, differential expression means an increased level of the marker for a positive marker, and a decreased level for a negative marker. The detectable level of the marker nucleic acid or polypeptide is sufficiently higher or lower in the cells of interest, compared to other cells, such that the cell of interest can be identified and distinguished from other cells, using any of a variety of methods known in the art. "c-Kit" and "CDI 17" both refer to a cell surface receptor tyrosine kinase having a sequence disclosed in Genbank Accession No. X06182, or a naturally occurring variant sequence thereof allelic variant). "CD9" is also referred to as "Motility-related protein-1 (MRP-1)" and is a transmembrane glycoprotein that has been implicated in cell adhesion, motility, proliferation, and differentiation. 24/05/06,15735 speci gp, 16 -17- ,O "CD10" is also referred to as "Common Acute Lymphocytic Leukemia Antigen S(CALLA)". CD10 is a cell surface enzyme with neutral metalloendopeptidase activity and it is expressed in lymphoblastic, Burkitt's, and follicular germinal center lymphomas and in patients with chronic myelocytic leukemia. It is also expressed on to 5 the surface of normal early lymphoid progenitor cells, immature B Cells within adult (N bone marrow and germinal center B Cells within lymphoid tissue. CDIO is also present on breast myoepithelial cells, bile canaliculi, fibroblasts, brush border of N, kidney and gut epithelial cells. Ci "CD44" is also referred to as "Hermes antigen" and is the main cell surface receptor for hyaluronan. This CD is primarily expressed in most cell types, except for O tissues/cells such as hepatocytes, some epithelial cells, and cardiac muscle. "CD49f" is also referred to as "a6 integrin" and "VLA-6," and associates with integrin subunit beta 1 to bind laminin. CD49f is expressed primarily on epithelial cells, trophoblasts, platelets, and monocytes. "CD73" is also referred to as "ecto-5'-nucleotidase" and is primarily expressed on a subset of-B and T cells, bone marrow stromal cells, various epithelial cells, fibroblasts, and endothelial cells. is also referred to as "Thy-I" and is primarily expressed on hematopoietic stem cells, connective tissue cells, and various fibroblastic and stromal cells. "SSEA-1" (Stage Specific Embryonic Antigen-1) is a glycolipid surface antigen present on the surface of murine teratocarcinoma stem cells murine and human embryonic germ cells and murine embryonic stem cells (ES). "SSEA-3" (Stage Specific Embryonic Antigen-3) is a glycolipid surface antigen present on the surface of human teratocarcinoma stem cells human embryonic germ cells and human embryonic stem cells (ES). "SSEA-4" (Stage Specific Embryonic Antigen-4) is a glycolipid surface antigen present on the surface of human teratocarcinoma stem cells human embryonic germ cells and human embryonic stem cells (ES). 24105/06,15735 speci gp,17 -18- "TRA1-60" is a keratin sulfate related antigen that is expressed on the surface of human teratocarcinoma stem cells human embryonic germ cells and human embryonic stem cells (ES). "TRA1-81" is a keratin sulfate related antigen that is expressed on the surface of human teratocarcinoma stem cells human embryonic germ cells and human embryonic stem cells (ES). "TRA2-49" is an alkaline phosphatase isozyme expressed on the surface of human teratocarcinoma stem cells and human embryonic stem cells (ES). "Oct-4" is a member of the POU-domain transcription factor and is widely regarded as a hallmark of pluripotent stem cells. The relationship of Oct-4 to pluripotent stem cells is indicated by its tightly restricted expression to undifferentiated pluripotent stem cells. Upon differentiation to somatic lineages, the expression of Oct-4 disappears rapidly. "EPCAM" is also referred to as "Epithelial Cell Adhesion Molecule" is broadly expressed on cells of epithelial origin and epithelial derived tumor cells. "Rex-l" is a developmentally regulated acidic zinc finger gene (Zfp-42). Rex-1 message level is high in embryonic stem cells and reduced upon induction of differentiation. As expected for a stem-cell-specific message, Rex-1 mRNA is present in the inner cell mass (ICM) of blastocyst, polar trophoblast of the blastocyst and later in the ectoplacental cone and extraembryonic ectoderm of the egg cylinder (trophoblast-derived tissues), but its abundance is much reduced in the embryonic ectoderm, which is directly descended from the ICM. "HNF-1 alpha", "HNF-1 beta" and "HNF-3 beta" belong to the hepatic nuclear factor family of transcription factors, which is characterized by a highly conserved DNA binding domain and two short carboxy-terminal domains. "GATA-4" and "GATA-6" are members of the GATA transcription factor family. This family of transcription factors are induced by TGF P signaling and contribute to the maintenance of early endoderm markers, Sox 1l7a and HNF-1 beta, and the later marker HNF-3 beta. 24/05/06.15735 spcci gp,18 -19u "SOX-17" is a transcription factor, which is implicated in the formation of endoderm Sduring embryogenesis. SBy "basic defined cell culture medium" is meant a serum free or serum containing, chemically defined cell growth medium. Such medium includes, but is not limited to, Dulbecco's Modified Eagle's Medium (DMEM), alpha modified Minimum Essential Medium (alpha MMEM), Basal Medium Essential (BME), CMRL-1066, RPMI 1640, M199 medium, Ham's F10 nutrient medium, KNOCKOUT M DMEM, J Advanced DMEM, MCDB based media such as MCDB -151, -153, -201, and -302 S(Sigma, MO), and DMEM/F12. These and other useful media are available from GIBCO, Grand Island, New York, for example. A number of these media C are reviewed in Methods in Enzymology, Volume LVIII, "Cell Culture," pp. 62-72, edited by William B. Jakoby and Ira H. Pastan, published by Academic Press Inc. "Hes-l", also known as "hairy/enhancer of split-I" is a transcription factor that may influence cell fate determination. "Musashi-l" is a member of a subfamily of RNA binding proteins that are highly conserved across species. Musashi-lexpression is highly enriched in proliferative cells within the developing central nervous system, and may be a stem cell marker in intestinal cells. "Pharmaceutical carrier" refers to a biodegradable or non-degradable porous or nonporous matrix that can act as a carrier for transplantation of mammalian cells. "Transplantation" as used herein, can include the steps of introducing a cell or a population of cells or tissue into a mammal such as a human patient. "Transplantation" may also include incorporating cells or tissue into a pharmaceutical carrier, and implanting the carrier in a mammal such as a human patient. Isolation of Amniotic Fluid-Derived Cells In one aspect of the present invention, amniotic fluid-derived cells are isolated by a multi-stage method, which essentially involves: 24/05/06.15735 speci gp,19 -Isolation of amniotic fluid, -Centrifugation of the amniotic fluid, followed by removal of the supernatant, Resuspending the cell pellet in growth medium, Culturing the tissues and cells in a low oxygen environment, -Leaving the culture undisturbed for about 5 to 10 days without any media changes, Isolation of distinct colonies using cloning rings, Culturing the isolated colonies in growth media Serial dilution cloning and identification of single cells that give rise to proliferating colonies, and Culturing the clones in growth media. In an alternate embodiment, amniotic fluid-derived cells are isolated by a multi-stage method, which essentially involves: Isolation of amniotic fluid, -Centrifugation of the amniotic fluid, followed by removal of the supernatant, Resuspending the cell pellet in growth medium, -Culturing the tissues and cells in a normoxic environment, Leaving the culture undisturbed for about 5 to 10 days without any media changes, -Isolation of distinct colonies using cloning rings, Culturing the isolated colonies in growth media, 24/05/06,15735 speci -21 -Serial dilution cloning and identification of single cells that give rise to proliferating colonies, and -Culturing the clones in growth media. The culture plates may be pre-coated with agents such as, for example, fibronectin, vitronectin, laminin, collagen, gelatin, thrombospondin, placenta extracts, MATRIGELTM, tenascin, human serum, or combinations thereof. If desirable, the amniotic fluid may be exposed, for example, to an agent (such as an antibody) that specifically recognizes a protein marker expressed by amniotic fluid cells, to identify and select amniotic fluid-derived cells, thereby obtaining a substantially pure population of amniotic fluid-derived cells. Amniotic fluid-derived cells may be cultured in AMNIOMAXT complete medium (Invitrogen). Alternatively, the cells may be cultured in Chang B/C medium (Irvine Scientific). Alternatively, the cells may be cultured in low glucose DMEM, supplemented with insulin-transferrin-selenium-X (ITS-X, Invitrogen, CA), 2% fetal bovine serum (FBS), 1% penicillin/streptomycin 25 ng/ml bFGF. Alternatively, the cells may be cultured in, DM-KNOCKOUT T M media (Invitrogen, CA), supplemented with 20% KNOCKOUTT M serum replacement (Invitrogen, CA), ng/ml bFGF. Alternatively, the cells may be cultured in Williams' medium E supplemented with 2% defined FBS, 2mM L-glutamine, ITS, 55 pM 2mercaptoethanol, 10ng/ml EGF, 4ng/ml bFGF, and 4ng/ml dexamethasone. Alternatively, the cells may be cultured in 1:1 DMEM-LG/MCDB 201, 2% FBS, ITS-X, pme 55 [LM, 100 [tM ascorbic acid-2-phosphate, 4ng/ml bFGF, EGF, and 4ng/ml dexamethasone. Alternatively, the cells may be cultured in low glucose DMEM, supplemented with 20% FBS. Alternatively, the cell may be cultured in low glucose DMEM, supplemented with 5% FBS. The cells may also be cultured in low glucose DMEM/MCDB 201 medium supplemented with 2% defined FBS, ITS-X, InM dexamethasone, 100 mM ascorbic acid 2-phosphate, EGF, 10ng/ml PDGF-bb and 100 mM 2-mercaptoethanol. The media may be supplemented with bFGF, at concentrations from about 5 ng/ml to about 100 ng/ml. Alternatively, the cells may be cultured in 20% KNOCKOUTTM serum 24/05/06.15735 speci gp.21 -22replacement 80% KNOCKOUTTM DMEM, supplemented with 1 mM L-glutamine, 1% non-essential amino acids and 0.1 mM 2-mercaptoethanol. The medium may be conditioned overnight, on human or murine embryonic fibroblasts, human bone marrow derived stromal cells, or human placenta derived cells and supplemented with 4 ng/ml bFGF. Alternatively, the cells may be cultured in high glucose DMEM, supplemented with 20% defined FBS with 0.1 mM 2- mercaptoethanol. Table 1II lists the various media formulations used to culture the amniotic fluid-derived cells of the present invention. During culture in growth media, the cells may be cultured under hypoxic or normoxic conditions. Under hypoxic conditions, oxygen levels are lower than alternatively lower than 10%, alternatively lower than but more than 1%. Preferably, the culture should be maintained in the growth media undisturbed for about 5 to 14 days without any media changes, at which point the cells have typically become adherent to the culture substrate used. At which point, cells may be subcultured. Subculture can be achieved with any of the enzymatic solutions well known to those skilled in the art. An example of an enzymatic solution suitable for use in the present invention is TrypLE EXPRESS T M (Invitrogen, Ca). Furthermore, the amniotic fluid-derived cells may be expanded by culturing in a defined growth media containing agent(s) that stimulate the proliferation of the cells of the present invention. These factors may include, for example, nicotinamide, members of TGF-0 family, including TGF-P31, 2, and 3, bone morphogenic proteins (BMP-2, 6, -11, -12, and serum albumin, fibroblast growth factor family, platelet-derived growth factor-AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, -10, 11), glucagon like peptide-I and II (GLP-I and II), GLP-1 and GLP-2 mimetobody, Exendin-4, retinoic acid, parathyroid hormone, insulin, progesterone, testosterone, estrogen, aprotinin, hydrocortisone, ethanolamine, beta mercaptoethanol, epidermal growth factor (EGF), gastrin I and II, copper chelators such as triethylene pentamine, TGF-at, forskolin, Na-Butyrate, activin, betacellulin, noggin, neuron growth factor, nodal, 24/05/06.15735 speci gp, 2 2 -23 insulin/transferrin/selenium (ITS), hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), bovine pituitary extract, islet neogenesis-associated protein (INGAP), proteasome inhibitors, notch pathway inhibitors, sonic hedgehog inhibitors, GSK-3 beta inhibitors, or combinations thereof. Alternatively, the amniotic fluid-derived cells may be expanded by culturing in conditioned media. By "conditioned media" is meant that a population of cells is grown in a basic defined cell culture medium and contributes soluble factors to the medium. In one such use, the cells are removed from the medium, while the soluble factors the cells produce remain. This medium is then used to nourish a different population of cells. In certain embodiments, the amniotic fluid-derived cells are cultured on standard tissue culture plates. Alternatively, the culture plates may be coated with extracellular matrix proteins, such as, for example, MATRIGEL growth factor reduced MATRIGEL laminin, collagen, gelatin, tenascin, fibronectin, vitronectin, thrombospondin, placenta extracts, human serum, or combinations thereof. Characterization of The Isolated Amniotic Fluid-Derived Cells Methods for assessing expression of protein and nucleic acid markers in cultured or isolated cells are standard in the art. These include quantitative reverse transcriptase polymerase chain reaction (RT-PCR), Northern blots, in situ hybridization (see, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds. 2001 supplement)), and immunoassays, such as immunohistochemical analysis of sectioned material, Western blotting, and for markers that are accessible in intact cells, flow cytometry analysis (FACS) (see, Harlow and Lane, Using Antibodies: A Laboratory Manual, New York: Cold Spring Harbor Laboratory Press (1998)). Examples of antibodies useful for detecting certain protein markers are listed in Table III. It should be noted that other antibodies directed to the same markers that are recognized by the antibodies listed in Table III are available, or can be readily developed. Such other antibodies can also be employed for assessing expression of markers in the cells isolated in accordance with the present invention. Characteristics of cells of the p-cell lineage are well known to those skilled in the art, and additional characteristics of the p-cell lineage continue to be identified. These 24/05/06.15735 speci gp, 2 3 -24characteristics can be used to confirm that the amniotic fluid-derived cells isolated in accordance with the present invention have differentiated to acquire the properties characteristic of the p-cell lineage. p-cell lineage specific characteristics include the expression of one or more transcription factors such as, for example, PDX-1 (pancreatic and duodenal homeobox gene-1), NGN-3 (neurogenin-3), Hlxb9, Nkx6, Isll, Pax6, NeuroD, Hnfla, Hnf6, Hnf3 Beta, and Mafa, among others. These transcription factors are well established in the art for identification of endocrine cells. See, Edlund (Nature Reviews Genetics 3: 524-632 (2002)). Characteristics of cells of the intestinal cell lineage are well known to those skilled in the art, and additional characteristics of this lineage continue to be identified. These characteristics can be used to confirm that the differentiated or undifferentiated amniotic fluid-derived cells isolated in accordance with the present invention have some of the properties characteristic of the intestinal cell lineage. Intestinal cell lineage characteristics include the expression of one or more transcription factors such as, for example, HES-1 (hairy/enhancer of split-1), NGN-3, Pax6, NeuroD, Math-1, and Musashi-1, among others. In addition, gut cells express hormones such as secretin, cholecystokinin, GLP-1, neurotensin, gastric inhibitory peptide (GIP), serotonin, somatostatin, and gastrin, among others. These transcription factors and gut hormones are well established in the art for identification of intestinal cells. See, Schonhoff (Endocrinology 145: 2639-2644 (2004)). The present inventors have identified and isolated a population of amniotic fluidderived cells that is highly proliferative, and displays embryonic cell-like characteristics, and may express at least one of the following markers: HNF-1 beta, HNF-3 beta, SOX-17, or GATA 6. In particular, the amniotic fluid-derived cells isolated in accordance with the present invention are characterized as, inter alia, substantially lacking at least one of the following protein markers: CDI 17, Oct-4 or Tra2-54. Populations of amniotic fluid-derived cells with these characteristics are referred to herein as AF-I (ATCC accession number PTA-6975). Under the above growth conditions for expansion, the amniotic fluid cells isolated in accordance with the present invention may be expanded for more than 50 population 24/05/06,15735 speci gp,24 doublings, while maintaining the potential to express at least one of the following markers: HNF-1 beta, HNF-3 beta, SOX-17, or GATA-6. The present inventors have also identified and isolated populations of amniotic fluidderived cells that is highly proliferative, displays embryonic cell-like characteristics, and do not express at least one of following markers: HNF-3 beta, SOX-17, GATA- 4, CD117, Oct-4 or Tra2-54. In particular, the amniotic fluid-derived cells isolated in accordance with the present invention are characterized as, inter alia, substantially lacking at least one of the following protein markers: CD117, Oct-4 or Tra2-54. Populations of amniotic fluid-derived cells with these characteristics are referred to herein as AF-II. The present inventors have also identified and isolated populations of amniotic fluidderived cells that is highly proliferative, displays embryonic cell-like characteristics, and do not express any of the following markers: HNF-3beta, SOX-17, GATA-4, CD117, Oct-4 or Tra2-54. In particular, the amniotic fluid-derived cells isolated in accordance with the present invention are characterized as, inter alia, substantially lacking at least one of the following protein markers: CD117, Oct-4 or Tra2-54. Populations of amniotic fluid-derived cells with these characteristics are referred to herein as AF-II. The present inventors have also identified and isolated populations of amniotic fluidderived cells that is highly proliferative, displays embryonic cell-like characteristics, and do not express cytokeratin and at least one of following markers: HNF-3 beta, SOX-17, GATA-4, CD117, Oct-4 or Tra2-54. In particular, the amniotic fluidderived cells isolated in accordance with the present invention are characterized as, inter alia, substantially lacking at least one of the following protein markers: CD1 17, Oct-4 or Tra2-54. Populations of amniotic fluid-derived cells with these characteristics are refered to herein as AF-III. The present inventors have also identified and isolated populations of amniotic fluidderived cells that is highly proliferative, displays embryonic cell-like characteristics, and do not express any of the following markers: cytokeratin, HNF-3beta, SOX-17, GATA-4, CD 117, Oct-4 or Tra2-54. In particular, the amniotic fluid-derived cells 24/05/06.15735 speci -26isolated in accordance with the present invention are characterized as, inter alia, substantially lacking at least one of the following protein markers: CD1 17, Oct-4 or Tra2-54. Populations of amniotic fluid-derived cells with these characteristics are refered to herein as AF-III. A summay of the expression profile of AF-I, AF-II and AF-III cells is shown in Figure 9. Amniotic fluid-derived cells of the present invention may be expanded for more than population doublings, while maintaining the potential to differentiate into definitive endoderm, or cells with characteristics of a pancreatic P- cell lineage, or the capacity to differentiate into a gut hormone-producing cell. Differentiation Of Amniotic Fluid-Derived Cells In one aspect, the present invention provides compositions capable of differentiating the expanded amniotic fluid-derived cells of this invention into cells bearing markers characteristic of the 3cell lineage. In another aspect, the present invention provides compositions capable of differentiating the expanded amniotic fluid-derived cells of this invention into cells bearing markers characteristic of definitive endoderm. In another aspect, the present invention provides compositions capable of differentiating the expanded amniotic fluid-derived cells of this invention into cells bearing markers characteristic of a gut hormone-producing cell. A basic defined culture medium, when supplied with one or more components, that support the growth of amniotic fluid-derived cells, supplemented with differentiation-inducing amounts of one or more growth factors, is referred to as an "induction medium." In accordance with the present invention, the induction medium contains less than or equal to 20% serum. In one embodiment, fetal calf serum may be used. Alternatively, fetal bovine serum may be replaced by serum from any mammal, or by albumin, bovine albumin or other compounds that permit or enhance differentiation of amniotic fluid-derived cells to the 13 cell lineage. Alternatively, the induction medium may be conditioned medium. 24/05/06.15735 speci gp,26 -27- Factors appropriate for use in the induction medium may include, for example, nicotinamide, members of TGF-P family, including TGF-P31, 2, and 3, bone morphogenic proteins (BMP-2, 6, -11, -12, and serum albumin, fibroblast growth factor family, platelet-derived growth factor-AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, 6, -10, 11), glucagon like peptide-I and II (GLP-I and II), GLP-1 and GLP-2 mimetobody, Exendin-4, retinoic acid, parathyroid hormone, insulin, progesterone, aprotinin, hydrocortisone, ethanolamine, beta mercaptoethanol, epidermal growth factor (EGF), gastrin I and II, copper chelators such as triethylene pentamine, TGFa, forskolin, Na-Butyrate, activin, betacellulin, ITS, noggin, neurite growth factor, nodal, valporic acid, trichostatin A, sodium butyrate, hepatocyte growth factor (HGF), sphingosine-1, Wnt proteins such as Wnt-1, -3a, 07a, and keratinocyte growth factor (KGF), Dickkopf protein family, bovine pituitary extract, islet neogenesis-associated protein (INGAP), Indian hedgehog, sonic hedgehog, proteasome inhibitors, notch pathway inhibitors, sonic hedgehog inhibitors, or combinations thereof. In one aspect of the present invention, a combination of growth factors and chemical agents, including bFGF, Activin-A, FGF5, N2 and B27 supplements (Gibco, CA), steroid alkaloid such as, for example, cyclopamine (EMD, CA) that inhibits sonic hedgehog signaling, and a proteasome inhibitor such as, for example MG132 (EMD, CA), is supplied to a basic defined medium to support differentiation of amniotic fluid-derived cells into a P-cell lineage. In one aspect, the cells are cultured in an induction media composed of DMEM (low glucose, 5.5 mM) containing micromolar MG-132 for 1-2 days, followed by additional incubation for 3-7 days in an induction media supplemented with IX B27 (Gibco, CA) and IX N2 (Gibco, CA) and further supplemented with Cyclopamine (10 pM; EMD, CA), bFGF (20 ng/ml; R&D Systems, MN), Activin A (20 nM; R&D Systems, MN) or FGF5 (20 ng/ml; R&D Systems, MN) for an additional five days. In another aspect of the invention, the cells of the current invention can be treated with conditioned media isolated from cultures of primary fetal intestinal or pancreatic rudiments to induce further differentiation into the intestinal or pancreatic 24/05/06.15735 spcci gp, 2 7 -28lineages, respectively. The cells may also be induce to differentiate with conditioned media from pancreatic cells lines such as PANC-1, CAPAN-1, BxPC-3, HPAF-II, hepatic cell lines such as HepG2, and intestinal cell lines such as, for example, FHs 74 and HS738. Altrenatively, the cells of the present invention can be treated with conditioned media isolated from human or mouse embryonic stem cells indiced to differentiate into an endodermal lineage. These cell lines can be purchased from the ATCC (VA). The combination and concentrations of growth factors, the length of culture, and other culture conditions can be optimized by those skilled in the art to achieve effective differentiation by, monitoring the percentage of cells that have differentiated into cells characteristic of the p-cell lineage. The one or more growth factors may be added in an amount sufficient to induce the differentiation of the amniotic fluid-derived cells of the present invention into cells bearing markers of a p-cell lineage over a time period of about one to four weeks. Therapeutic Use of The Cells of The Present Invention. In one aspect, the present invention provides a method for treating a patient suffering from, or at risk of developing Type l diabetes. This method involves isolating and culturing amniotic fluid-derived cells, expanding the isolated population of cells, differentiating the cultured cells in vitro into a P-cell lineage, and implanting the differentiated cells either directly or in a pharmaceutical carrier into the patient. If appropriate, the patient can be further treated with pharmaceutical agents or bioactives that facilitate the survival and function of the transplanted cells. These agents may include, for example, insulin, members of the TGF-P family, including TGF- 1, 2, and 3, bone morphogenic proteins (BMP-2, -11, -12, and fibroblast growth factors-1 and platelet-derived growth factor-AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor -10, vascular endothelial cell-derived growth factor (VEGF), pleiotrophin, endothelin, among others. Other pharmaceutical compounds can include, for example, nicotinamide, glucagon like peptide-I (GLP-1) and II, GLP-1 and 2 mimetibody, Exendin-4, retinoic acid, parathyroid hormone, MAPK inhibitors, 24/05/06,15735 speci gp,28 -29such as, for example, compounds disclosed in U.S. Published Application 2004/0209901 and U.S. Published Application 2004/0132729. In yet another aspect, this invention provides a method for treating a patient suffering from, or at risk of developing Type 2 diabetes. The method involves isolating and culturing amniotic fluid-derived cells according to the present invention, expanding the isolated population of cells, differentiating the cultured cells in vitro into a P-cell lineage, and implanting the differentiated cells either directly or in a pharmaceutical carrier into said patient. In yet another embodiment, the amniotic fluid-derived cells of the present invention may be cryopreserved using commercially available medium containing DMSO (dimethylsulfoxide) or glycerol. The banked and frozen cells may be stored in the vapor phase of a liquid nitrogen storage tank until needed. In yet another embodiment, the amniotic fluid-derived cells of the present invention may be transplanted with mature islets of the same or different animal species to enhance the survival of the amniotic fluid-derived cells or to induce further differentiation of the amniotic fluid-derived cells into a pancreatic P cell lineage. The source of amniotic fluid from which the cells are isolated may be autologous in relation to the patient undergoing the therapeutic treatment. Alternatively, the source may be allogeneic, or xenogeneic. Cells to be administered to a patient may also be genetically modified to enhance proliferation and/or differentiation or prevent or lessen the risk of immune rejection. Alternatively, the amniotic fluid-derived cells obtained in accordance with the present invention can be used to modulate the recipient's immune response, prior to transplantation of differentiated cells prepared in accordance with the present invention. See, for example, U.S. Patent 6,328,960, U.S. Patent 6,281,012. The amniotic fluid-derived cells of the present invention may be differentiated into an insulin-producing cell prior to transplantation into a recipient. In a specific embodiment, the amniotic fluid-derived cells of the present invention are fully differentiated into P-cells, prior to transplantation into a recipient. Alternatively, the amniotic fluid-derived cells of the present invention may be transplanted into a 24/05/06,15735 speci gp,29 recipient in an undifferentiated or partially differentiated state. Further differentiation may take place in the recipient. The amniotic fluid-derived cells of the present invention may be genetically modified. For example, the cells may be engineered to over express markers characteristic of a cell of a P-cell lineage, such as, for example, PDX-I or insulin. The cells may be engineered to over express with any suitable gene of interest. Furthermore, the cells may be engineered to over express markers characteristic of an intestinal cell, such as MATH-1. Alternatively, the cells of the present invention can be differentiated into a GIP expressing cell population and further modified with an insulin gene under control of the GIP promoter to become glucose responsive and insulin-producing cell population. Techniques useful to genetically modify the amniotic fluid-derived cells of the present invention can be found, for example, in standard textbooks and reviews in cell biology. Methods in molecular genetics and genetic engineering are described, for example, in Molecular Cloning: A Laboratory Manual, 2nd Ed. (Sambrook et al., 1989); Oligonucleotide Synthesis J. Gait, ed., 1984); Animal Cell Culture I. Freshney, ed., 1987); the series Methods in Enzymology (Academic Press, Inc.); Gene Transfer Vectors for Mammalian Cells (I. M. Miller P. Calos, eds., 1987); Current Protocols in Molecular Biology and Short Protocols in Molecular Biology, 3rd Edition M. Ausubel et al., eds., 1987 &1995); and Recombinant DNA Methodology II Wu ed., Academic Press 1995). The nucleic acid molecule, encoding the gene of interest may be stably integrated into the genome of the host amniotic fluid-derived cell, or the nucleic acid molecule may be present as an extrachromosomal molecule, such as a vector or plasmid. Such an extrachromosomal molecule may be auto- replicating. The term "transfection," as used herein, refers to a process for introducing heterologous nucleic acid into the host amniotic fluid-derived cell. The cells, undifferentiated or otherwise, may be used as dispersed cells or formed into clusters that may be infused into the hepatic portal vein. Alternatively, the cells may be provided in biocompatible degradable polymeric supports, porous nondegradable devices or encapsulated to protect from host immune response. The cells 24/05/06,15735 speci -31may be implanted into an appropriate site in a recipient. The implantation sites include, for example, the liver, natural pancreas, renal subcapsular space, omentum, peritoneum, subserosal space, intestine, stomach, or a subcutaneous pocket. To enhance further differentiation, survival or activity of implanted cells, additional factors, such as growth factors, antioxidants or anti-inflammatory agents, can be administered before, simultaneously with, or after the administration of the cells. In certain embodiments, growth factors are utilized to differentiate the administered cells in vivo. These factors can be secreted by endogenous cells and exposed to the administered amniotic fluid-derived cells in situ. Implanted amniotic fluid-derived cells can be induced to differentiate by any combination of endogenous and exogenously administered growth factors known in the art. The amount of cells used in implantation depends on a number of factors including the patient's condition and response to the therapy, and can be determined by one skilled in the art. In one aspect, this invention provides a method for treating a patient suffering from, or at risk of developing diabetes. The method includes isolating and culturing amniotic fluid-derived cells according to the present invention, expanding the isolated population of cells, differentiating in vitro the cultured amniotic fluidderived cells into a 3-cell lineage, and incorporating the cells into a threedimensional support. The cells can be maintained in vitro on this support prior to implantation into the patient. Alternatively, the support containing the cells can be directly implanted in the patient without additional in vitro culturing. The support can optionally be incorporated with at least one pharmaceutical agent that facilitates the survival and function of the transplanted cells. Support materials suitable for use for purposes of the present invention include tissue templates, conduits, barriers, and reservoirs useful for tissue repair. In particular, synthetic and natural materials in the form of foams, sponges, gels, hydrogels, textiles, and nonwoven structures, which have been used in vitro and in vivo to reconstruct or regenerate biological tissue, as well as to deliver chemotactic agents for inducing tissue growth, are suitable for use in practicing the methods of the 24/05/06, 15735 speci gp.31 -32present invention. See, the materials disclosed in U.S. Patent 5,770,417, U.S. SPatent 6,022,743, U.S. Patent 5,567,612, U.S. Patent 5,759,830, U.S. Patent 6,626,950, U.S. Patent 6,534,084, U.S. Patent 6,306,424, U.S. Patent 6,365,149, U.S. SPatent 6,599,323, U.S. Patent 6,656,488, and U.S. Patent 6,333,029. Exemplary polymers suitable for use in the present invention are disclosed in U.S. Published Application 2004/0062753 Al and U.S. Patent 4,557,264. To form a support incorporated with a pharmaceutical agent, the pharmaceutical agent can be mixed with the polymer solution prior to forming the support. Alternatively, a pharmaceutical agent could be coated onto a fabricated support, preferably in the presence of a pharmaceutical carrier. The pharmaceutical agent C may be present as a liquid, a finely divided solid, or any other appropriate physical form. Alternatively, excipients may be added to the support to alter the release rate of the pharmaceutical agent. In an alternate embodiment, the support is incorporated with at least one pharmaceutical compound that is an anti-inflammatory compound, such as, for example compounds disclosed in U.S. Patent 6,509,369. In one embodiment, the support is incorporated with at least one pharmaceutical compound that is an anti-apoptotic compound, such as, for example, compounds disclosed in U.S. Patent 6,793,945. In another embodiment, the support is incorporated with at least one pharmaceutical compound that is an inhibitor of fibrosis, such as, for example, compounds disclosed in U.S. Patent 6,331,298. In a further embodiment, the support is incorporated with at least one pharmaceutical compound that is capable of enhancing angiogenesis, such as, for example, compounds disclosed in U.S. Published Application 2004/0220393 and U.S. Published Application 2004/0209901. In still another embodiment, the support is incorporated with at least one pharmaceutical compound that is an immunosuppressive compound, such as, for example, compounds disclosed in U.S. Published Application 2004/0171623. 24/05/06,15735 speci gp 3 2 -33 IN In a further embodiment, the support is incorporated with at least one pharmaceutical compound that is a growth factor, such as, for example, members of the TGFfamily, including TGF- 1, 2, and 3, bone morphogenic proteins (BMP-2, S6, -11, -12, and fibroblast growth factors-1 and platelet-derived growth tt 5 factor-AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, -10, vascular endothelial cell-derived growth factor (VEGF), pleiotrophin, endothelin, among others. Other C pharmaceutical compounds can include, for example, nicotinamide, hypoxia 0 inducible factor 1-alpha, glucagon like peptide-I (GLP-1), GLP-1 and GLP-2 D 10 mimetibody, and II, Exendin-4, nodal, noggin, NGF, retinoic acid, parathyroid Shormone, tenascin-C, tropoelastin, thrombin-derived peptides, cathelicidins, defensins, laminin, biological peptides containing cell- and heparin-binding domains of adhesive extracellular matrix proteins such as fibronectin and vitronectin, MAPK inhibitors, such as, for example, compounds disclosed in U.S. Published Application 2004/0209901 and U.S. Published Application 2004/0132729. The incorporation of the cells of the present invention into a scaffold can be achieved by the simple depositing of cells onto the scaffold. Cells can enter into the scaffold by simple diffusion Pediatr. Surg. 23 (1 Pt 3-9 (1988)). Several other approaches have been developed to enhance the efficiency of cell seeding. For example, spinner flasks have been used in seeding of chondrocytes onto polyglycolic acid scaffolds (Biotechnol. Prog. 14(2): 193-202 (1998)). Another approach for seeding cells is the use of centrifugation, which yields minimum stress to the seeded cells and enhances seeding efficiency. For example, Yang et al. developed a cell seeding method Biomed. Mater. Res. 55(3): 379-86 (2001)), referred to as Centrifugational Cell Immobilization (CCI). The present invention is further illustrated, but not limited by, the following examples. 24/05/06,15735 spcci gp. 3 3 1 -34- Example 1 The Establishment of Human Amniotic Fluid-Derived Cell Lines Amniotic fluid used to isolate the cells of the present invention was taken from samples taken from routine amniocentesis performed at 16 to 22 weeks of gestation for fetal karyotyping. The multi-stage method used to isolate the amniotic fluidderived cells is outlined in Figure 1. The amniotic fluid was centrifuged for 7 minutes at 400 x g and the supernatant removed. The resulting cell pellet was resuspended in the growth media indicated in Table III for the amniotic fluid samples used in the present invention. The cells were cultured either on collagen type IV (lmg/100 mm plate), or on collagen type I (1 microgram/cm 2 vitronectin microgram/ml) or fibronectin (10 micrograms/ml) coated plates. The cell yield from amniotic fluid samples had a large variation (8000-300000 cell/sample) and some samples also contained a significant number of blood cell contamination. The cultures were left undisturbed for at least 5-10 days under hypoxic conditions (3% 02). In parallel, cultures were established under similar conditions in normoxic conditions. Next, the cultures were fed with the same growth media and cultured until the cultures reached 70-80% confluency. Cells at this stage were referred to as In some cultures, colonies of cells were isolated by a cloning ring and sub cultured into a different culture plate. Distinct colonies were present with morphologies characteristic of fibroblast amniotic fluid and epithelial (E) cells (Figure Cells were released from PO culture by using TrypLE Express TM (Invitrogen) and seeded into fibronectin, vitronectin, or collagen type IV coated flaks/dishes/plates at various densities (50-10,000 cell/cm2). Some of the PO cells were used for serial dilution cloning. The population doubling time of the fastest growing cells was approximately 24 hrs at early passages. The expanded cells cultured under various media conditions (Table II) were analyzed for cell surface markers (Table III). Cells were typically split at -70% confluency and reseeded at 100-10000 cells/cm 2 RNA was collected at various stages of cell growth and analyzed for embryonic and germ layer markers (Table V). 24/05/06,15735 speci gp,34 Amniotic fluid cells of the present invention were present at various gestational ages. Table VI lists the presence or absence of AF, E, and F morphologies in amniotic fluid samples obtained at 17 weeks to 41 weeks of gestation. Amniotic fluid cells of the present invention were also obtained from amniotic fluid obtained at term (approximately 40 wks of gestation). Amniotic fluid samples were obtained from 38-40 wk deliveries and cultured according to the protocols outlined above. The resulting adherent cell populations displayed very similar characteristics to the cells isolated from 16-22 wks of gestation. Example 2 Clonal Expansion of the Cells of the Present Invention Using methods described in Example 1, cells with AF-like morphologies were harvested from PO cultures using cloning rings. Three distinct populations of cells exhibiting different expression of surface receptors, cytoskeletal proteins, and transcription factors were identified. For sake of clarity, these populations are referred to as AF-I, AF-II, and AF-III cells. Subsequent examples highlight the differences between AF-I, -II, and -III populations. Example 3 Fluorescence-Activated Cell Sorting (FACS) Analysis Adhered cells were removed from culture plates by five-minute incubation with the TRYPLEM express solution (Gibco, CA). Released cells were resuspended in DMEM supplemented with 10% FBS and recovered by centrifugation, followed by washing and resuspending the cells in a staining buffer consisting of 2% BSA, 0.05% sodium azide (Sigma, MO) in PBS. If appropriate, the cells were Fc-receptor blocked using a 0.1% y-globulin (Sigma) solution for 15 min. Aliquots (approximately 105 cells) were incubated with either phycoerythirin (PE) or allophycocyanin (APC) conjugated monoclonal antibodies (5 tl antibody per 106 cells), as indicated in Table III-A, or with an unconjugated primary antibody. Controls included appropriate isotype matched antibodies, non-stained cells, and cells only stained with secondary conjugated antibody. All incubations with 24/05/06.15735 speci -36antibodies were performed for 30 mins at 4 0 C, after which the cells were washed with the staining buffer. Samples that were stained with unconjugated primary antibodies were incubated for additional 30 mins at 4°C with secondary conjugated PE or -APC labeled antibodies. See Table III-B for a list of secondary antibodies used. Washed cells were pelleted and resuspended in the staining buffer and the cell surface molecules were identified by using a FACS Array (BD Biosciences) by collecting at least 10,000 events. For intracellular staining, cells were first fixed for 10 mins with 4% paraformaldheyde, followed by two rinses in the staining buffer, centrifugation of t0 cells and resuspension of the cells in a permeabilization buffer containing Triton-X (Sigma) in PBS for 5 mins at room temperature The permeabilized cells were rinsed twice with a rinsing buffer, centrifuged, and resuspended in the staining buffer and incubated with an appropriate conjugated antibody (5 pl antibody per 106 cells), for 30 mins at 4 0 C. Samples that were stained with unconjugated primary antibodies were incubated for additional 30 mins at 4 0 C with secondary conjugated PE or -APC labeled antibodies (Table III Washed cells were pelleted and resuspended in the staining buffer and the internal proteins were identified by using a FACSArray (BD Biosciences) by collecting at least 10,000 events. The expression level of examined surface and internal markers is listed in Table IV A and B. FACS analysis allowed identification of signature markers to distinguish amniotic fluid cells (AF-I, -II, and -III), fibroblasts and epithelial cells (Figures Table IV C lists the cell surface expression profile of AF-I cells isolated from term (38-40 wks) amniotic fluid. The expression level of cell surface receptors is very similar to AF-I cells isolated from 16-22 wks amniotic fluid. Example 4 Immunostaining of Undifferentiated Cells 10,000 cells/cm 2 cells, cultured according to Example 1, were seeded into glass bottom 35 mm microwell dishes (Matek Corp, MA) in various growth media. Following three days in culture, the cells were fixed for 10 mins with 4% paraformaldheyde, followed by two rinses in the PBS, and addition of a 24/05/06,15735 speci gp.36 -37- O permeabilization buffer containing 0.5% Triton-X (Sigma) for 5 mins at room Stemperature (RT) followed by additional three rinses with PBS. The fixed and permeabilized cells were blocked with either 1% bovine serum albumin (BSA) or 4% sera from the species where the secondary antibody was raised in (Goat, donkey, or tf 5 rabbit). Control samples included reactions with the primary antibody omitted or where the primary antibody was replaced with corresponding immunoglobulins at the same concentration as the primary antibodies. Stained samples were rinsed with a PROLONG® antifade reagent (Invitrogen, CA) containing diamidino-2phenylindole, dihydrochloride (DAPI) to counter stain the nucleus. Images were acquired using a Nikon Confocal Eclipse C-l inverted microscope (Nikon, Japan) 0and a 10-60X objective (Figures 6 8). (N Example PCR Analysis Of Undifferentiated Cells RNA was extracted from cells cultured in the growth media. Total RNA from human pancreas, liver, brain ,gut (Ambion, INC.) NTERA cells (human embryonic carcinoma cells line, ATCC), HEK293 cells (ATCC), and human airway epithelia cells (Cambrex) were used as positive controls. Bone marrow derived mesenchymal cells (Cambrex, MD) were used as negative controls for the expression of key genes involved in pancreatic development. RNA extraction, purification, and cDNA synthesis. RNA samples were purified through its binding to a silica-gel membrane (Rneasy Mini Kit, Qiagen, CA) in the presence of an ethanol-containing, high-salt buffer; while contaminants were washed away. The RNA was further purified while bound to the column by treatment with DNase I (Qiagen, CA) for 15 min. High-quality RNA was then eluted in water. Yield and purity were assessed by A260 and A280 readings on the spectrophotometer. cDNA copies were made from purified RNA using an ABI (ABI, CA) high capacity cDNA archive kit. Real-time PCR amplification and quantitative analysis. Unless otherwise stated, all reagents were purchased from Applied Biosystems. Real-time PCR reactions were performed using the ABI PRISM® 7000 Sequence Detection System. TAQMAN® 24/05/06,15735 spcci gp,3 7 -38- UNIVERSAL PCR MASTER MIX@ (ABI, CA) was used with 20 ng of reverse transcribed RNA in a total reaction volume of 20 pl. Each cDNA sample was run in duplicate to correct for pipetting errors. Primers and FAM-labeled TAQMAN@probes were used at concentrations of 200 nM. The level of expression of each target gene was normalized using the pre-developed Applied Biosystem's 18S ribosomal RNA or human glyceraldehydes-3 -phosphate dehydrogenase 1 (GAPDH) endogenous control kit. Primers and probes were either designed using SABI PRISM PRIMER EXPRESS T M software or used pre-developed ABI gene analysis kit. For each gene, either one of the primers or the probe were designed to be exon-boundary spanning. This eliminated the possibility of the primers/probe binding to any genomic DNA present. The primer and probe sets are listed as following Nkx2.2 (Hs00159616), Pdx-1 (Hs00426216), Nkx6.1 (Hs00232355), Ngn3 (Hs00360700), Pax4 (Hs00173014), Pax6 (Hs00240871), Insulin (Hs00355773), Glu2 (HsOO 165775), glucagon (HsOO 174967), Isl-1 (HsOO 158126), somatostatin (Hs00174949), FoxA2 (HNF 3-beta) (Hs00232764), HIxB9 (Hs00232128), GATA-4 (Hs00171403), HNF1P (Hs00172123), Musashi Homolog 1 (Msi-l) (Hs00159291), Hes-1 (Hs00172878), Neurotensin (NTS) (Hs00175048), Cholecystokinin (Hs00174937), AFP (Hs00173490), Secretin (Hs00360814), GIP (Hs00175030), GFAP (Hs00157674), MAP2 (Hs00159041), Olig2 (Hs0037782), Oct-4 (CGACCATCTGCCGCTTTGAG (SEQ ID NO: 1) and CCCCCTGTCCCCCA TTCCTA (SEQ ID NO: Rex-1 (CAGATCCTAAACAGCTCGCAGAAT (SEQ ID NO: and GCGTACGCAAATTAAACTCCAGA(SEQ ID NO: Soxl7: TGGCGCAGCAGATACCA (SEQ ID NO:5), AGCGCCTTCCACGACTTG (SEQ ID NO:6) and CCAGCATCTTGCTCAACTCGGCG (SEQ ID NO:7); ABCG-2: GTTTATCCGTGGTGTGTCTGG (SEQ ID NO: 8) and CTGAGCTATAGAGGCCTGGG (SEQ ID NO: SOX2: ATGCACCGCTACGACGTGA (SEQ ID NO: 10) and CTTTTGCACCCCTCCCATTT (SEQ ID NO: 11). The remaining primers were designed by using the PRIMERS program (ABI, CA) and are listed in Table V. After an initial 50 0 C for 2 min, and 95 0 C for 10 min, samples were cycled 40 times in two stages a denaturation step at 95 0 C for 15 sec, followed by an 24/05/06.15735 speci gp38 -39annealing/extension step at 60 0 C for 1 min. Data analysis was carried out using GENEAMP®7000 Sequence Detection System software. For each primer/probe set, a Ct value was determined as the cycle number at which the fluorescence intensity reached a specific value in the middle of the exponential region of amplification. Relative gene expression levels were calculated using the comparative Ct method. Briefly, for each cDNA sample, the endogenous control Ct value was subtracted from the gene of interest Ct to give the delta Ct value (ACt). The normalized amount of target was calculated as 2 A c t assuming amplification to be 100% efficiency. Final data were expressed relative to a calibrator sample. The comparative Ct method is only valid if target and endogenous control amplification efficiencies are approximately equal. Preliminary validation experiments were therefore performed for each primer/probe set by amplifying serially diluted cDNA samples and determining the ACt values. These ACt values should remain constant across the range of dilutions if amplification efficiencies are equal (Table V). Example 6 Population doubling time Passage 6 amniotic fluid cells (AF-I type), isolated and expanded according to Example 1 were seeded at 10000 cells/well of a 24-well tissue culture plate (Coming, MA) in growth media #11. At various time points, cells were removed from three wells of the plate using TRYPLEM Express (Invitrogen, CA) and counted using a Guava PCA-96 cell analysis system and the VIACOUNT® reagent (Guava, CA). Figure 10 depicts the growth curve of passage 6 cells cultured under hypoxic conditions 02). The linear phase of the log plot was used to estimate the population doubling time of the cells. Population doubling time of passage 6 cells was 31 hrs. The growth potential of the three cell populations (fibroblast, AF, and epithelial morphology) were compared over long-term cultures. Figure 11 depicts the growth potential of AF-I, AF-II, AF-III, F, and E cells cultured in media It is clear that F ("fibroblastic" amniotic fluid-derived) cells and AF cells can expand well above population doublings and represent a scalable source for cell therapy applications. 24/05/06.15735 speci gp,39 Example 7 Telomere length of AF-I cells The telomere length of an AF-I line isolated from a single cell by limited serial dilution was analyzed at passage 12 (approximately 50 population doublings) by using the Telo TAGGG Telomere Length Assay (Roche, IN) and following the manufacturer's instruction. The telomere length was analyzed for cells cultured in DMEM-LG 10 FBS and cells cultured in AmniomaxTM (Gibco) see Figure 12. DNA from NTERA cells served as a positive control. Example 8 Karyotype analysis The karyotype of AF cells, isolated from mutliple donors at passage 8-10 (approximately 30 population doublings), was determined by G-band analysis. Five karyotypes were prepared and cytogenetic analysis showed that the cells had a normal autosomes and a modal chromosome number of 46. All cells analyzed also contained the X and Y-chromosomes confirming their fetal origin. Figure 13 depicts karyotypes of amniotic fluid-derived cells (AF-I, AF-II, and AF-III) isolated from amniotic fluid obtained from 16-22 weeks of gestation. Example 9 Expansion potential of AF cells derived from term amniotic fluid Figure 14 depicts the expansion potential of an AF-I cell morphology derived from term amniotic fluid (-38 weeks) and cultured in media The expansion potential is very similar to the AF-I cells isolated from 16-22 wks amniotic fluid. Example Microarray analysis of fibroblast, epithelial, and amniotic fluid morphology cells Total RNA was isolated from passage 9-11 amniotic fluid-derived fibroblast cells amniotic fluid-derived epithelial cells amniotic fluid-derived amniotic fluid 24/05/06,15735 speci -41cells (AF- I, -II, and -III lines), and amniotic fluid at term (AF term) using an RNeasy mini kit (Qiagen). The sample preparation, hybridization, and image analysis was performed according to the CodeLinkTM System (GE Healthcare, Amersham Biosciences, NJ). CodelinkTM Human Whole Genome arrays were used. It is comprised of approximately 55 000 30-mer probes designed to conserved exons across the transcripts of targeted genes. The chip contains -45000 unique Unigene IDs. Following normalization and a log transformation, data analysis was performed using OmniViz® software (MA) and GENESIFTER (VizXLabs, WA). The variance stabilizing transformation along with cross sample normalization was applied to the log transformed array dataset. The variability within each cell line and among the different cell lines was compared using the Pearson correlation coefficient. For all the samples analyzed, the correlation coefficient within a cell line was higher as compared to those between the lines. Variance in gene expression profiles between the different cell types along with the correlation coefficient between the lines are depicted in Figure 15. Significant differences in gene expression between the cell types were evaluated using analysis of variance and an F-test with adjusted P-value (Benjamini and Hochberg correction) of 0 0.05. Tables VII A-G list the genes that are differentially expressed at least 5-fold between the various cell types. Example 11 Differentiation of cells into intestinal-like cells The AF-I line, AFCA007 Clone A passage 14, was cultured at 10,000 cells/cm 2 in AMNIOMAX' At confluency, the cells were further treated for 2 weeks with a daily dose of 10 micro molar retinoic acid (RA) in AMNIOMAXTM media. RNA was collected at day 14 and expression of intestinal hormones (secretin, neurotensin, gastric inhibitory peptide (GIP), cholecystokinin, somatostatin, and gastrin) was assessed by using real-time PCR as outlined in Example 4. Intestinal RNA (Ambion) was used to assess relative levels of expression using the AACt method. Table VIII lists the Ct values and the relative level of expression of the intestinal hormones in treated and untreated samples. As shown in Table VIII, addition of RA enhanced expression of the gut hormones. 24/05/06,15735 speci gp,41 -42- Example 12 Differentiation of cells into multiple endocrine lineages Cells from the cell line AFCA007 Clone A (AF-I) at passage 8 were embedded in collagen type I (Becton Dickinson, CA) with 1% growth-factor reduced matrigel matrix (Becton Dickinson), and seeded into 6-well transwell insert at 5x105 cells per well. The bottom well was seeded with human aortic endothelial cells passage 6 (Cambrex. MD). Cells were cultured with DMEM medium supplemented with FBS and growth factors, which includes Cyclopamine, bFGF, EGF, BMP4-7, Activin A, Exendin 4, FGF4, all-trans retinoic acid and y-secretase inhibitors for 14 days. Cultures were fed every other day. Cells treated by all-trans retinoic acid showed the up-regulation of alpha-fetoprotein (AFP). Treatment of cells with Activin A, BMP4, or the y-secretase inhibitor L-685,458 up-regulated the expression of HNF-3 beta. Treatment of cells with BMPs at high concentration, 50 ng/ml, also up-regualted the GATA4 expression. Treatment of cells with FGF4 at 50 ng/ml showed an up-regulation of PDX-1 expression (Table IX). Cells from the cell line AFCA004 (E morphology) at passage 6 were seeded at 5xl0 cells per well of 6-well culture plates and treated with conditioned medium from confluent PANC-1 cells (ATCC, VA) in combination with different growth factors. Basic FGF, EGF and combination of bFGF and EGF enhanced the expression of HNF-3 beta -100 fold over untreated cells. Basic FGF, EGF and BMPs also stimulated somatostatin expression after 14 days treatment (Figure 16, panels a&b). Taken together, these results suggest that AF cells could be differentiated into pancreatic, hepatic or intestinal lineage by treating the cells with different growth factors. Example 13 Modulation of the expression of endoderm makers by inhibiting the Notch pathway Cells from the cell line AFCA007 (AF-I) at passage 8 were treated with a range of concentrations of the notch pathway inhibitor L-685,458 (Sigma, MO) for 3 to 24/05/06,15735 speci gp,42 -43days. The cytotoxcity of L-685,458 was determined by measuring cell viability by a MTS assay (Promega, WI). Real-time PCR analysis was performed to analyze Hes-1 expression after the treatment. We found that L-685,458 showed a dose-dependent inhibitory effect on Hes-1 expression, Hes-1 is the downstream direct target of Notch pathway (Figure 17, panel No effect on cell viability, as determined by the MTS assay, was observed following L-685,458 treatment of up to 10M for 5 days (Figure 17, panel b). Example 14 Cytokine antibody array analysis for AF I and AF II cells AFCA007 A (AF-I) and AFCAO 15 C (AF-II) at passage 10 were grown to approximately 70 confluency and then cell lystaes was collected using mammalian cell lysis kit (Sigma-Aldrich, MO). Cytokine array analyss was completed using Cytokine Array panels provided by RayBiotech, GA (http://www.raybiotech.com/). Table X lists cytokine, cytokine and growth factor receeptor expression following normalization of the data and background subtraction. For each panel, positive and negative controls are also included. The panels were run for two different samples per cell type. 24/05/06.15735 speci gp.43 44 TABLE 1: COMPARISON OF THE CELL OF THE PRESENT INVENTION WITH AMNIOTIC FLUID-DERIVED CELLS OF THE ART. Marker Cell I Cell 2 Cell 3 Cell 4 CD1O CD105 Weak CD1I CDII17 Weak CD13 CD29 (Beta+ 1 integrin) CD31 CD34 Weak CD44 CD49b (Alpha 2 integrin) CD349e (Alpha integrin) CD73 CD166 24/05/06, 15735 speci gp,44 HLA ABC HLA D- Oct-4 SSEA-1 SSEA-3 SSEA-4 Stro-1I Telomerase TRAI1-60 IRA 1-81 TRA 1-85 IRA 2-49 TRA 2-54+ 24/05/06.15735 speci 6p,45 -46- TABLE II. MEDIA FORMULATIONS USED TO CULTURE AMNIOTIC- FLUID DERIVED CELLS. Media formulation 1 DMEM-LG ITS-X 1% P/S 2% FBS 25 ng/ml bFGF 2 Advanced DMEM ITS-X 1% P/S 1% FBS 25 ng/ml bFGF 3 Alpha MEM: MCDB 153 ITS-X 1% P/S 1% FBS ng/ml bFGF 4 Defined Keratinocyte growth media (Gibco, NY) AMNIOMAX TM complete media (Gibco, NY) 6 Chang B/C (Irvine Scientific, CA) 7 Chang D (Irvine Scientific, CA) 8 DM-KNOCKOUTTM media (Invitrogen, CA), supplemented with KNOCKOUTTM serum replacement (Invitrogen, ng/ml bFGF 9 DMEM- Low glucose, supplemented with 20% FBS DMEM- Low glucose, supplemented with 5% FBS 11 DMEM- low glucose /MCDB 201 medium supplemented with 2% defined FBS, ITS-X, InM dexamethasone, 100 mM ascorbic acid 2-phosphate, IOng/ml EGF, IOng/ml PDGF-bb and 100 mM 2-mercaptoethanol 12 20% KNOCKOUT T M serum replacement 80% KNOCKOUTM DMEM, supplemented with 1 mM L-glutamine, 1% non-essential amino acids and 0.1 mM 2-mercaptoethanol 24/05/06.15735 speci gp,46 47 IND 13 The medium may be conditioned overnight, on human or murine embryonic fibroblasts, human bone marrow derived stromal cells, or human placenta derived cells and supplemented with 4 nglml bFGF 14 high glucose DMEM, supplemented with 20% defined FBS with 0. 1 mM 2- mercaptoethanol Williams' E medium, 2% FBS, I X ITS, 55uM fPme, I X Glutamax (Gibco), I1%P/S, IlOng/mi EGF, 4ng/ml bFGF, 4ng/ml dexamethasone 16 1: 1 DMEM-LG/MCDB 201, 2% FBS, ITS-X, fOme ascorbic acid-2-phosphate, 4ng/ml bFGF, IlOng/ml EGF, 4ng/ml dexamethasone 24/05/06,15735 speci gp.47 -48- TABLE III A: ANTIBODIES TO SURFACE RECEPTORS. Antibody Supplier Isotype Clone CD117 (c-Kit) Santa Cruz Goat IgG M-14 Biotechnology (CA) CD 117 (c-Kit) Santa Cruz Mouse IgG 1 104D2 Biotechnology (CA) CD117 (c-Kit) BD Pharmingen Mouse IgGI, kappa YB5.B8 (CA) CD24 BD Pharmingen Mouse IgG2A, (CA) Kappa CD44 BD Pharmingen Mouse IgG2b, G44-26 (CA) Kappa BD Pharmingen Mouse IgG1, (CA) Kappa CD49f BD Pharmingen Rat IgG2A, Kappa GOH3 (CA) CD73 BD Pharmingen Mouse IgGI, AD2 (CA) Kappa BD Pharmingen Mouse IgG1, HIlOa (CA) Kappa CD105 Santa Cruz (CA) Mouse IgGI P3D1 CD49b (Alpha 2 BD Pharmingen Mouse IgG2a, 121-H6 integrin) (CA) Kappa 24/05/06,15735 speci gp. 4 8 49 Alpha 3 integrin Santa Cruz (CA) Mouse IgG 1 P1 Alpha 4 integrin BD Pharrningen Mouse IgG 1, 9F (CD49d) (CA) Kappa Alpha 5 intgerin BID Pharmingen Mouse IgG I, IAlI (CD49e) (CA) Kappa CD49f (Alpha 6 BD Pharmingen Rat lgG2a GoH3 integrin) (CA) CD29 (Beta I BD Pharmingen Mouse IgGI1, MAR4 integrin) (CA) Kappa Beta 3 integrin Santa Cruz (CA) Mouse IgG I Y2/51 Alpha V Beta 3 BD Pharmingen Mouse IgG I, 23C6 integrin (CD5I/61) (CA) Kappa SSEA-3 Chemnicon (CA) Mouse IgG3 MC-631 SSEA-4 Chemnicon (CA) Rat IgM MC-813-70 TRA 1-60 Chemnicon (CA) Mouse IgM TRA 1-60 IRA 1-81 Chemnicon (CA) Mouse 1gM TRA 1-81 TRA 1-85 Chemicon (CA) Mouse IgG I TRA 1-85 IRA 2-54 Chemnicon (CA) Mouse IgGi IIRA 2-54 EGF r BD Pharmingen Mouse IgG2b, EGFRI (CA) Kappa EpCAM BD Pharmingen Mouse IgG I EBA-1 (CA) HLA ABC BD Pharmingen Mouse IgG I, G46-2.6 (CA) Kappa 24/05/06,15735 speci gp,49 50 HLA DR BD Pharmingen Mouse IgG2b, TU36 (CA) Kappa BD Pharmingen Mouse IgGI, kappa 5E10 (CA) 24/05/06.15735 speci -51 TABLE III B: LIST OF SECONDARY CONJUGATED ANTIBODIES USED FOR FACS AND IMMUNOSTAINININGANALYSIS. Secondary conjugated Supplier Dilution antibody Goat Anti-Mouse IgG APC Jackson ImmunoResearch 1:200 conjugated (PA) Goat Anti-Mouse IgG PE Jackson ImmunoResearch 1:200 conjugated (PA) Donkey anti-rabbit PE or Jackson ImmunoResearch 1:200 APC conjugated (PA) Donkey anti-goat PE or Jackson ImmunoResearch 1:200 APC conjugated (PA) Goat anti-mouse IgM PE SouthernBiotech (AL) 1:200 Goat anti-Rat IgM PE SouthernBiotech (AL) 1:200 Goat anti-mouse IgG3 PE SouthemBiotech (AL) 1:200 24/05/06,15735 speci gp51 I -52- TABLE III C: LIST OF PRIMARY ANTIBODIES USED FOR IMMUNOSTAINININGANALYSIS. Antibody Supplier Dilution Beta III Tubulin R&D Systems (MN) 1:100 C-Kit Santa Cruz Biotechnology 1:100 (CA) Cytokeratin 18 Sigma (MO) 1:100 Cytokeratin 8 Sigma (MO) 1:100 Cytokeratin-7 Santa Cruz Biotechnology 1:100 (CA) Cytokeratin 19 Sigma (MO) 1:100 E-Cadherin BD Transduction 1:100 Laboratories (CA) FOXA1 Chemicon International 1:100 (CA) GATA-6 R&D Systems (MN) 1:100 HES-1 Chemicon International 1:100 (CA) HES-2 Chemicon International 1:100 (CA) HNF-1 alpha BD Transduction 1:100 Laboratories (CA) HNF-1 beta BD Transduction 1:100 Laboratories (CA) 24/05/06,15735 speci gp,52 -53- Musashi-1 Chemicon International 1:100 (CA) Nestin R&D Systems (MN) 1:100 Pan-Cytokeratin (CK, 4, 5, Santa Cruz Biotechnology 1:100 6, 10, 13, and 18) (CA) SOX-17 R&D Systems (MN) 1:100 SSEA-4 Santa Cruz Biotechnology 1:100 (CA) TRA 1-81 Santa Cruz Biotechnology 1:100 (CA) Vimentin Santa Cruz Biotechnology 1:100 (CA) ZO-1 BD Transduction 1:100 Laboratories (CA) 24/05/06,15735 spcci gp.53 -54- TABLE IV A: CELL SURFACE RECEPTORS ON FIBROBLAST, AMNIOTIC FLUID, AND EPITHELIAL CELLS DERIVED FROM ANMNIOTIC FLUID AND GROWN UNDER HYPOXIC CONDITIONS Fibroblast Amniotic fluid Amniotic Amniotic Epithelial cells cells (AF-I) fluid cells fluid cells cells (E) (AF-II) (AF-III) Alpha 3 integrin Beta 1 integrin Beta 3 Weak Weak integrin Alpha V Weak Weak Beta 3 (CD51/ 61) C-Met CD24 Weak Weak Weak Weak CD105 Weak CD117 CD13 Weak CD44 CD73 24/05/06,15735 speci gp.54 55 EpCAM HLA ABC HLA 11- DR TRA2- 49 SSEA-4 SSEA-3 TRAI- TRAlI- 81 24/05/06,15735 speci 56 TABLE IV B: INTRACELLULAR PROTEINS OF VARIOUS AMNIOTIC FLUID CELL TYPES GROWN IN MEDIA Marker Fibroblast Amniotic Amniotic Amniotic Epithelial cells fluid cells fluid cells fluid cells cells (E) (AF-I) (AF-IL) (AF-ILI) CK-19 Vimentin Smooth Weak Weak Weak Weak muscle actin Beta III tubulin Pan cytokeratin Cytokeratin 7 Cytokeratin 8 Cytokeratin 18 Nestin Weak 24105/06,15735 spect gp,56 57 'No ct TABLE IV C: CELL SURFACE RECEPTORS ON AMNIOTIC FLUID CELLS DERIVED FROM TERM ANMNIOTIC FLUID AND GROWN UNDER HYPOXIC CONDITIONS Amniotic fluid cells (AF- 1) Alpha 3 integrin BetalI integrin Beta 3 integrin Alpha V Beta 3 1/61) CD1O Weak Weak CDI 17 CDI3 Weak CD44 CD73 EpCAM HLA ABC HLA 11- 24/05/06,15735 speci gp.5 7 58 SSEA-4 TRAI1-60 TRAl1-81 TABLE V: PCR ANALYSIS OF THE AMNIOTIC FLUID-DERIVED CELLS OF THE PRESENT INVENTION a. Pluripotency markers Markers Fibroblast Epithelial AF-I AF-11 AF-111 Ntera-1 Cells cells Cells Cells Cells Oct3/4 Sox-2 Rex- I hTERT b. Endocrine markers Epithelial cells Cell Markers Fibroblast cells AF I cells AFII cells AFIII cells SoxI17 Weak GATA-6 24/05/06,15735 speci gp,58 59 GATA-4 Weak T Weak]I HfNF1IBeta HNF3 beta Weak-- Pdx- I NGN-3 Musashi-I HES-1 Neuroli I Pax Pax6+++-- Secretin----- Gastric inhibitory peptide (GIP) Glucagon---- Somatostatin Cholecystokinin Gastrin---- Insulin -Weak- Nestin 24/05/06,15735 speci gp.59 60 *Weak: CT values of 35-38 cycles N CT value <35 cycles 24/05/06,15735 speci 61 TABLE VI: PRESENCE OF ALL AF, E, AND F MORPHOLOGIES AT VARIOUS GESTATIONAL AGES IN SECOND TRIMESTER AMNIOTIC FLUID SAMPLES. AF designation Gestation age Presence of Presence of E- Presence of F- AF-like like like morphology morphology morphology AFCAOO 1 17 wks AFCA002 18 wks AFCA004 18 wks AFCA008 18 wks AFDXOO 1 19 wks AFDX021 20 wks AFDX022 20 wks AFCA007 19 wks AFCA009 18 wks AFCAO 0 l8wks AFCAO 11 19 wks AFCAO 17 16 wks AFPNO03 20 wks AFPNO04 20 wks AFNDOO1 41 wks 24/05/06,15735 speci gp,61 62 TABLE VII A: GENES THAT WERE DIFFERENTIALLY EXPRESSED AT LEAST 5 FOLD IN FIBROBLAST VERSUS AF-I CELLS Gene Identifier Gene Name Average fold change in fibroblast versus AF cells Direction adj. pvalue NM_002421 NM_144594 NM_020927 NM_001451 Homo sapiens matrix metalloproteinase 1 (interstitial collagenase) (MMP1), mRNA Homo sapiens hypothetical protein FLJ32942 (FLJ32942), mRNA Homo sapiens KIAA1 576 protein (KIAA1 576), mRNA Homo sapiens forkhead box F1 (FOXFI), mRNA AK021 543 Homo sapiens cDNA FLJ 11481 fis, clone HEMBA1 001803 434.28 UP 207.74 UP 200.11 UP 183.69 UP 131.1 UP 120.15 UP 112.45 UP 109.54 UP 102.84 UP 1 .09E-03 2.52E-03 5.06E-04 1 .52E-03 3.11 E-03 2.07E-03 7.69E-04 1 .63E-03 1.72E-03 NM_007036 NM_002448 NM_152270 NM_000474 Homo sapiens endothelial cellspecific molecule 1 (ESMi), mRNA Homo sapiens msh homeo box homolog 1 (Drosophila) (MSX1), mRNA Homo sapiens hypothetical protein FLJ34922 (FLJ34922), mRNA Homo sapiens twist homolog 1 (acrocephalosyndactyly 3; Saethre- Chotzen syndrome) (Drosophila) (TWISTi), mRNA 24/05/06,15735 speci 6p,62 63 AK1 22739 AV702977 Homo sapiens cDNA FLJ 16260 fis, clone IMR322006947, highly similar to Rattus norvegicus mRNA for dHand protein AV702977 ADB Homo sapiens cONA clone ADBCVD08 5, mRNA sequence AK026784 Homo sapiens cONA: FLJ23131 fis, clone LNG08502 NM_000710 NM_000609 NM_030781 NM_032638 NM_000362 NM_198148 AL831 863 NM_002091 Homo sapiens bradykinin receptor B1 (BDKRBI), mRNA Homo sapiens chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) (CXCL12), mRNA Homo sapiens collectin sub-family member 12 (COLEC12), transcript variant 11, mRNA Homo sapiens GATA binding protein 2 (GATA2), mRNA Homo sapiens tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory) (TIMP3), mRNA Homo sapiens carboxypeptidase X (M 14 family), member 2 (CPXM2), mRNA Homo sapiens mRNA; cONA DKFZp761J2O17 (from clone DKFZp761J2O 17) Homo sapiens gastrin-releasing peptide (GRP), mRNA 98.04 UP 93.67 UP 87.77 UP 86.86 UP 77.16 UP 64.54 UP 63.54 UP 61.32 UP 57.01 UP 55.07 UP 53.77 UP 4.82E-03 2.91 E-03 1 .52E-03 4.77E-03 2.97E-03 8.99 3. 35E-03 5.06 E-03 4. OOE-03 7. 57E-03 9.01 E-03 24/05106.15735 speci Mp. 63 64 NM_020404 NM_014178 NM_205855 BX08901 9 A1124557 NM_139211 NM_002593 BQ020357 CA843592 NM_002852 NM_000089 Homo sapiens CD164 sialomucinlike 1 (CID164L-1), mRNA Homo sapiens syntaxin binding protein 6 (amisyn) (STXBP6), mRNA Homo sapiens HWKM 1940 (UNQ194O), mRNA BX089019 Soares-testisNHT Homo sapiens cONA clone IMAGp998K243513; IMAGE:1391375, mRNA sequence am58g02.xl Johnston frontal cortex Homo sapiens cDNA clone IMAGE:1539794 3, mRNA sequence Homo sapiens homeodomain-only protein (HOP), transcript variant 2, mRNA Homo sapiens procollagen Cendopeptidlase enhancer (PCOLCE), mRNA Ul-H-EDO-axk-p-07-0-UI si NCICGAPEDO Homo sapiens cDNA clone IMAGE:5830134 3, mRNA sequence ir49c12.xl HR85 islet Homo sapiens cONA clone IMAGE:6548544 3, mRNA sequence Homo sapiens pentaxin-related gene, rapidly induced by IL-i beta (PTX3), mRNA Homo sapiens collagen, type 1, alpha 2 (COL1A2), mRNA 51.44 UP 47.27 UP 42.6 UP 42.17 UP 37.2 UP 34.14 UP 30.85 UP 30.74 UP 29.57 UP 29.35 UP 28.94 UP 2.22E-04 7.17E-03 2.31 E-03 8.50E-03 8.24E-03 1 .45E-04 2.64E-03 5.91 E-03 6.22E-05 3.55E-03 4.61 E-04 24/05/06.15735 speci gp, 64 65 CD677332 holl5fO6.yl Human Trabecular 28.67 UP 1.15E-04 meshwork cDNA: hohphq Homo sapiens cONA clone hol5fO6 mRNA sequence t BC030692 Homo sapiens ELAV (embryonic 28.22 UP 7.64E-03 (Ni lethal, abnormal vision, Drosophila)like 2 (Hu antigen mRNA (cONA clone MGC:2631 9 IMAGE:4826082), (Ni complete cds (iAK021543 Homo sapiens cDNA FLA11481 fis, 27.4 UP 1.70E-02 clone HEMBA1001 803 A1962169 wq45clO.xl NCICGAPGC6 Homo 27.1 UP 8.11 E-03 sapiens cDNA clone IMAGE:2474226 3, mRNA sequence NM_000685 Homo sapiens angiotensin 11 26.59 UP 4.86E-03 receptor, type 1 (AGTR1), transcript variant 1, mRNA A1422199 tf58d04.xl NCICGAPBrn23 Homo 26.11 UP 1.04E-02 sapiens cONA clone IMAGE:2103463 3, mRNA sequence Homo sapiens GATA binding protein 24.62 UP 3.24E-03 NM_0010022 3 (GATA3), transcript variant 1, mRNA NM_000396 Homo sapiens cathepsin K 24.58 UP 4.37E-05 (pycnodysostosis) (CTSK), mRNA N M_00 1442 Homo sapiens fatty acid binding 24.37 UP 8.07E-03 protein 4, adipocyte (FABP4), mRNA NM_004460 Homo sapiens fibroblast activation 24.15 UP 1.93E-04 protein, alpha (FAP), mRNA AB067499 Homo sapiens mRNA for KIAA1 912 23.83 UP 2.51 E-03 protein, partial cds 24/05/06,15735 speci gp, 6 66 NM_032777 Homo sapiens G protein-coupled receptor 124 (GPR124), mRNA U831 15 Human non-lens beta gammacrystallin like protein (AIMII) mRNA, partial cds AY335938 Homo sapiens homeodomain protein IRXA1 (IRX1) mRNA, complete cds 22.29 UP 21.93 UP 21.54 UP 21.53 UP 21.16 UP 3.83E-03 5.28E-04 2.02E-02 2.20E-03 8.46E-05 NM_006350 Homo sapiens follistatin (EST), transcript variant FST317, mRNA W38393 zbl1 cO7. rl Soares-fetal-lungNbHL19W Homo sapiens cDNA clone IMAGE:.302 124 mRNA sequence NM_021637 Homo sapiens transmembrane protein 35 (TMEM35), mRNA 20.78 UP 20.71 UP 3.74E-04 1. 19E-02 AK091731 Homo sapiens cDNA FLJ34412 fis, clone HEART2002432 NM_032883 NM_005110 NM_024633 NM_004811 NM_153183 Homo sapiens chromosome 20 open reading frame 100 mRNA Homo sapiens glutamine-fructose-6phosphate transaminase 2 (GFPT2), mRNA Homo sapiens chromosome 14 open reading frame 139 (Cl4orfl39), mRNA Homo sapiens leupaxin (LPXN), mRNA Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 10 (NUDTIO), mRNA 20.29 UP 19.69 UP 19.44 UP 18.74 UP 18.51 UP 2. 33E-04 9.13E-05 1 .05E-02 1.74E-05 9. 88E-03 24/05106,15735 speci gp. 6 6 67 NM_014459 BX1 15659 NM_018013 Homo sapiens protocadherin 17 (PCDH17), mRNA BX115659 Soares-total-fetusNb2HF8_9w Homo sapiens cDNA clone IMAGp998C204119; IMAGE:1623883, mRNA sequence Homo sapiens hypothetical protein FLJ10159 (FLJ1O159), mRNA 18.39 UP 18.15 UP 17.64 UP 16.09 UP 1.39E-03 4.07E-04 1 .54E-02 2.35E-02 BX112628 BX112628 Soares-fetal-lungNbHL19W Homo sapiens cDNA clone IMAGp998A09669; IMAGE:299024, mRNA sequence NM_016428 NM_012449 NM_006350 Homo sapiens ABI gene family, member 3 (ABI3), mRNA Homo sapiens six transmembrane epithelial antigen of the prostate (STEAP), mRNA Homo sapiens follistatin (FST), transcript variant FST3 17, mRNA AF052115 Homo sapiens clone 23688 mRNA sequence 16.07 UP 16.07 UP 15.98 UP 15.92 UP 15.9 UP 15.59 UP 15.59 UP 15.57 UP 1.15 E-02 1 .49E-04 6.30E-05 1.56E-02 4.75E-04 2.68E-02 7.87E-03 8.59E-04 NM_004787 Homo sapiens slit homolog 2 (Drosophila) (SLIT2), mRNA AK091336 Homo sapiens cDNA FLJ34017 fis, clone FCBBF2002626 NM_006329 NM_000963 Homo sapiens fibulin 5 (FBLNS), mRNA Homo sapiens prostaglandinendoperoxide synthase 2 (prostaglandin G/H synthase and 24/05/06,15735 speci gp,6 7 68 NM_001 146 NM_018431 NM_017577 cyclooxygenase) (PTGS2), mRNA Homo sapiens angiopoietin 1 (ANGPT1), transcript variant 1, mRNA Homo sapiens docking protein 5 (00Kb), transcript variant 1, mRNA Homo sapiens hypothetical protein DKFZp434C0328 (DKFZp434C0328), mRNA 14.89 UP 14.56 UP 14.47 UP 13.8 UP 9.40E-04 8.69E-03 4.20E-03 1.13E-04 H85497 yv88b07.rl Soares melanocyte 2NbHM Homo sapiens cIDNA clone IMAGE:249781 5, mRNA sequence NM_001 147 NM_000090 Homo sapiens angiopoietin 2 (ANGPT2), mRNA Homo sapiens collagen, type IlI, alpha 1 (Ehlers-Danlos syndrome type IV, autosomal dominant) (COL3A), mRNA 13.76 UP 13.63 UP 13.35 UP 2.64E-02 1.65E-02 1 .86E-02 NM_007289 Homo sapiens membrane metalloendopeptidase (neutral endopeptidase, enkephalinase, CALLA, CIDlO) (MME), transcript variant 2b, mRNA NM_016229 NM_000810 NM_002518 Homo sapiens cytochrome b5 reductase b5R.2 (CYB5R2), transcript variant 1, mIRNA Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha mRNA Homo sapiens neuronal PAS domain protein 2 (NPAS2), mRNA 13.35 UP 13.07 UP 12.99 UP 12.93 UP 9.80E-03 2.71 E-02 1.04E-02 2.09E-03 AK093256 Homo sapiens cDNA FLJ35937 fis, 24/05/06,15735 speci gp.68 -69clone TESTI2011480 NM_005127 NM 006209 Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 2 (activation-induced) (CLECSF2), mRNA Homo sapiens ectonucleotide pyrophosphatase/phosphodiesteras e 2 (autotaxin) (ENPP2), mRNA W03013 za02c04.rl Soares melanocyte 2NbHM Homo sapiens cDNA clone IMAGE:291366 5 similar to contains THR.t3 THR repetitive element;, mRNA sequence AF131813 Homo sapiens clone 24970 mRNA sequence BQ025821 UI-1-BB1p-aye-f-10-0-UI.sl NCI_CGAP_PI6 Homo sapiens cDNA clone UI-1-BBlp-aye-f-10-0- UI 3, mRNA sequence AW445209 UI-H-BI3-akc-g-11-0-UI.s1 Homo sapiens cDNA clone IMAGE:2733908 3, mRNA sequence NM_033292 Homo sapiens caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase) (CASP1), transcript variant alpha, mRNA 12.82 UP 12.62 UP 12.43 UP 12.17 UP 12.15 UP 12.09 UP 11.63 UP 2.71E-02 2.60E-02 7.69E-04 2.57E-02 1.30E-02 8.91 E-04 2.67E-02 NM_170744 NM_012204 Homo sapiens unc-5 homolog B (C. elegans) (UNC5B), mRNA Homo sapiens general transcription factor IIIC, polypeptide 4, 11.62 UP 11.59 UP 3.68E-02 3.11E-02 24/05/06,15735 speci gp, 6 9 70 (GTF3C4), mRNA NM_002531 BG1 18019 NM_014802 BX64754 1 NM_020809 NM_016307 NM_057179 Homo sapiens neurotensin receptor 1 (high affinity) (NTSR1), mRNA 602351269F1 NIHMGC_90 Homo sapiens cDNA clone IMAGE:4446065 5, mRNA sequence Homo sapiens KIAA0528 gene product (KIAA0528), mRNA Homo sapiens mRNA; cDNA DKFZp686P0492 (from clone DKFZp686P0492) Homo sapiens Rho GTPase activating protein 20 (ARHGAP2O), mRNA Homo sapiens paired related homeobox 2 (PRRX2), mRNA Homo sapiens twist homolog 2 (Drosophila) (TWIST2), mRNA 11.33 UP 11.16 UP ii.o5 UP 10.9 UP 10.85 UP 10.85 UP 10.83 UP 10.82 UP 10.74 UP 10.72 UP 10.64 UP 10.61 UP 2.65E-02 8.51 2.84E-02 1 .65E-03 2.74E-02 7.71 7.22E-05 1 .20E-02 2.16E-02 2.65E-02 2.15E-03 1.87E-04 AK128325 Homo sapiens cONA FLJ46467 fis, clone THYMU3022668 BE866150 601679068F1 NIHMGC_53 Homo sapiens cDNA clone IMAGE:3961768 5, mRNA sequence BX109483 BX109483 NCICGAP_0v23 Homo sapiens cDNA clone IMAGp998C165481 IMAGE:2216391, mRNA sequence C02345 HUMGS0007544 Human adult (K.Okubo) Homo sapiens cONA, mRNA sequence NM_002961 Homo sapiens S100 calcium binding 24/05/06,1 5735 speci jp,7O 71 NM_031908 NM_013387 protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog) (S100A4), transcript variant 1, mRNA Homo sapiens Clq and tumor necrosis factor related protein 2 (C1QTNF2), mRNA Homo sapiens ubiquinol-cytochrome c reductase complex (7.2 kD) (HSPCO51), transcript variant 1, mRNA IND 10.13 UP 9.95 UP 9.76 UP BC039369 Homo sapiens, clone IMAGE:5271073, mRNA, partial cds 3.04E-02 4.17E-04 4.82E-03 2.21 E-02 2.37E-04 2.55E-02 BQ934941 NM_006670 BC046364 AGENCOURT_8810373 NIHMGC_101 Homo sapiens cDNA clone IMAGE:6429485 mRNA sequence Homo sapiens trophoblast glycoprotein (TPBG), mRNA Homo sapiens flavoprotein oxidloreductase MICAL3, mRNA (cONA clone IMAGE:5737121), with apparent retained intron Homo sapiens chromosome 16 open reading frame 30 (Cl6orf3O), mRNA 9.53 UP 9.37 UP 9.09 UP NM_024600 AK023647 Homo sapiens clDNA EUJ 13585 fis, clone PLACE 1009 150 NM_017805 NM_1 52399 Homo sapiens Ras interacting protein 1 (RASIPi), mRNA Homo sapiens hypothetical protein FLJ30834 (FLJ30834), mRNA 9.09 UP 8.81 U P 8.78 UP 8.73 UP 8.61 U P 4.32E-02 2.25E-03 2.38E-03 2.18E-02 5-08E-02 NM_002851 Homo sapiens protein tyrosine 24/05106,15735S speci gp,71 72 phosphatase, receptor-type, Z polypeptide 1 (PTPRZ1), mRNA AK024653 Homo sapiens cDNA: FLJ21 000 fis, clone CAE03359 NM_020226 NM_012307 NM_002203 NM_203370 NM_015192 AK056725 NM_005328 NM_012294 AA1 87037 NM_001463 Homo sapiens PR domain containing 8 (PRDM8), mRNA Homo sapiens erythrocyte membrane protein band 4. 1-like 3 (EPB341L-3), mRNA Homo sapiens integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) (ITGA2), mRNA Homo sapiens similar to RIKEN cDNA 65304181-21 (L0C3891 19), mRNA Homo sapiens phospholipase C, beta 1 (phosphoinositide-specific) (PLCB transcript variant 1, mRNA Homo sapiens cDNA FLJ32 163 fis, clone PLACE6000371 Homo sapiens hyaluronan synthase 2 (HAS2), mRNA Homo sapiens Rap guanine nucleotide exchange factor (GEF) mRNA zp58e04.rl Stratagene endothelial cell 937223 Homo sapiens cONA clone IMAGE:624414 5, mRNA sequence Homo sapiens frizzled-related protein (FRZB), mRNA 8.51 U P 8.48 UP 8.41 U P 8.3 UP 8.27 UP 8.26 UP 8.22 UP 8.2 UP 8.08 UP 7.95 UP 7.94 UP 6.29E-03 1.49E-04 7.37E-03 8.37E-05 8.21 2.64E-03 1 .68E-04 4.39E-02 4.94E-02 1 .09E-02 1.31 E-03 24/05/06,15735 speci gp, 7 2 73 BM468332 AGENCOURT_6432296 NIHMGC_71 Homo sapiens cDNA clone IMAGE:5535773 5, mRNA sequence AK096661 Homo sapiens cDNA FLJ39342 fis, clone OCBBF201 8873 7.94 UP 7.82 UP 7.67 UP 7.59 UP 7.42E-05 2.30E-03 1.10E-04 1.14E-04 NM_001849 Homo sapiens collagen, type VI, alpha 2 (COL6A2), transcript variant 2C2, mRNA BC071787 Homo sapiens cDNA clone IMAGE:4610527, partial cds NM_012105 NM_014217 Homo sapiens beta-site APPcleaving enzyme 2 (BACE2), transcript variant a, mRNA Homo sapiens potassium channel, subfamily K, member 2 (KCNK2), mRNA 7.58 UP 7.58 UP 7.47 UP 2.OOE-04 4.61 E-02 1 .75E-02 N28431 yx35c03.rl Soares melanocyte 2NbHM Homo sapiens cONA clone IMAGE:263716 5 similar to SP:PIR:S32603 S32603 collagen alpha 1(VI) chain mouse;, mRNA sequence NM_012445 NM_000304 NM_004791 Homo sapiens spondin 2, extracellular matrix protein (SPON2), mRNA Homo sapiens peripheral myelin protein 22 (PMP22), transcript variant 1, mRNA Homo sapiens integrin, beta-like 1 (with EGF-like repeat domains) (ITGBL1), mRNA 7.22 UP 7.02 UP 7.02 UP 4.03E-02 4.58E-02 2.64E-02 24/05/06,15735 speci gp, 7 3 74 NM_053044 BC028245 NM_023003 AJ420 536 NM_1 52996 NM_005583 NM_016270 NM_005397 NM_006182 U79271 BC036034 Homo sapiens serine protease HTRA3 (HTRA3), mRNA Homo sapiens, Similar to hypothetical gene L0C130797, clone IMAGE:5395354, mRNA Homo sapiens transmembrane 6 superfamily member 1 (TM6SF1), mRNA Homo sapiens mRNA full length insert cONA clone EUROIMAGE 994183 Homo sapiens sialyltransferase 7 Ipha-N -acetyl neu ram inyl-2,3-betagalactosyl-1 ,3)-N-acetyl galactosaminide alpha-2,6sialyltransferase) C (SIAT7C), mRNA Homo sapiens lymphoblastic leukemia derived sequence 1 (LYLl), mRNA Homo sapiens Kruppel-like factor 2 (lung) (KLF2), mRNA Homo sapiens podocalyxin-like (PODXL), mRNA Homo sapiens discoidin domain receptor family, member 2 (DDR2), mRNA Human clones 23920 and 23921 mRNA sequence Homo sapiens endothelial differentiation, lysophosphatidic acid G-protei n-co upled receptor, 2, 6.86 UP 6.86 UP 6.86 UP 6.79 UP 6.79 UP 6.77 UP 6.55 UP 6.53 UP 6.52 U P 6.31 U P 6.3 UP 1.13 E-03 1 .28E-02 2.12E-03 3.53E-04 4.08E-02 1.92E-02 5.02E-02 3.68E-03 8.46E-05 8.59E-05 3.07E-04 24/05/06,15735 speci gp.74 75 NM_152314 AK095791 NM 004840 AL833655 NM_032270 NM_021643 AW044647 transcript variant 2, mRNA (cDNA clone MGC:.33157 IMAGE:.5272431), complete cds Homo sapiens hypothetical protein MGC34830 (MGC34830), mRNA Homo sapiens cDNA FLJ38472 fis, clone FEBRA2022148 Homo sapiens Rac/Cdc42 guanine nucleotide exchange factor (GEE) 6 (ARHGEF6), mRNA Homo sapiens mRNA; cONA DKFZp66700320 (from clone DKFZp66700320) Homo sapiens factor for adipocyte differentiation 158 (FAD158), mRNA Homo sapiens tribbles homolog 2 (Drosophila) (TRIB2), mRNA wy78e09.xl Soares_NSF_F8_9W_OT_PA_P_Si Homo sapiens cDNA clone IMAGE:2554696 3, mRNA sequence 6.29 UP 6.27 UP 6.2 UP 6.18 UP 6.1 UP 5.97 UP 5.94 UP 5.85 UP 2.93 E-04 1 .74E-03 1 .32E-03 3.01 E-02 6.22E-05 8.59E-05 4.09E-02 3.94E-03 AK125284 Homo sapiens cDNA FLJ43294 fis, clone MESTC1000042 NM_005069 NM_018836 NM_014932 Homo sapiens single-minded homolog 2 (Drosophila) (SIM2), transcript variant SIM2, mRNA Homo sapiens transmembrane protein SHREWi (SHREWi), mRNA Homo sapiens neuroligin 1 (NLGN1), mRNA 5.84 UP 5.83 UP 5.83 UP 5.77 UP 8.35E-05 2.71 E-02 2.45E-03 4.30E-04 NM_006307 Homo sapiens sushi-repeat- 24/05/06,15735 speci 76 NM_000210 BG208475 containing protein, X-Iinked (SRPX), mRNA Homo sapiens integrin, alpha 6 (ITGA6), mRNA RST27977 Athersys RAGE Library Homo sapiens cONA, mRNA sequence 5.77 UP 5.72 UP 7.49E-05 1 .46E-03 N36786 yy34e08.sl Soares melanocyte 2NbHM Homo sapiens cDNA clone IMAGE:2731 58 3 similar to contains element MSR1 repetitive element;, mRNA sequence 5.67 UP 9.13E-05 NM_005308 AB037722 NM_012242 NM_003068 NM_080806 NM_173553 Homo sapiens G protein-coupled receptor kinase 5 (GRK5), mRNA Homo sapiens mRNA for KIAA1 301 protein, partial cds Homo sapiens dickkopf homolog 1 (Xenopus laevis) (DKK1), mRNA Homo sapiens snail homolog 2 (Drosophila) (SNAI2), mRNA Homo sapiens collagen, type XIII, alpha 1 (CaLl 3A1), transcript variant 10, mRNA Homo sapiens hypothetical protein FLJ25801 (FLJ25801), mRNA 5.58 UP 5.58 UP 5.57 UP 5.53 UP 5.52 U P 5.48 UP 5.45 UP 1 .35E-02 9.1 8E-04 1 .68E-04 7.42E-05 8.65 1 .77E-02 4.77E-03 A1085016 ow88e06.sl Soares-fetal-liver -spleen_1 NFLS_ Si Homo sapiens cDNA clone IMAGE:1653922 3, mRNA sequence NM_1 82728 Homo sapiens solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 (SLC7A8), 5.34 UP 2.70E-02 24105/06,15735 speci gp. 7 6 77 transcript variant 2, mRNA BC035066 NM_016247 NM_001704 NM_005226 NM_017413 NM_000576 NM_012307 AL831 835 NM_000955 Homo sapiens, clone IMAGE:5259543, mRNA Homo sapiens interphotoreceptor matrix proteoglycan 2 (IMPG2), mRNA Homo sapiens brain-specific angiogenesis inhibitor 3 (BAI3), mRNA Homo sapiens endothelial differentiation, sphingolipid Gprotein-coupled receptor, 3 (EDG3), mRNA Homo sapiens apelin, AGTRLI ligand (APLN), mRNA Homo sapiens interleukin 1, beta (11-11), mRNA Homo sapiens erythrocyte membrane protein band 4.1 -like 3 (EPB341L13), mRNA Homo sapiens mRNA; cDNA DKFZp547AO515 (from clone DKFZp547A051 Homo sapiens prostaglandin E receptor 1 (subtype EPi), 42kDa (PTGER1), mRNA Homo sapiens potassium inwardlyrectifying channel, subfamily J, member 16 (KCNJI6), transcript variant 1, mRNA Homo sapiens a disintegrin-like and metalloprotease (reprolysin type) 5.29 UP 5.22 UP 5.19 UP 5.18 UP 5.14 UP 5.1 UP 5.09 UP 5.04 UP 5.02 UP 2.24E-02 2.97E-03 1 .08E-02 1 .53E-04 2.48E-02 3.32E-03 4.93E-04 4.14E-02 3.12E-03 NM_018658 NM_007038 334.17 Down 250.9 Down 8.59E-05 3.32E-05 24/05/06,15735 speci gp, 77 78 with thrombospondin type 1 motif, (aggrecanase-2) mRNA RST39494 Athersys RAGE Library Homo sapiens cDNA, mRNA sequence BG21 9729 182.25 Down 6.10E-05 AB032980 Homo sapiens mRNA for KiAA1 154 protein, partial cds 159.9 Down 151.72 Down 7.49E-05 3.05E-05 NM_022454 Homo sapiens SRY (sex determining region Y)-box 17 (SOXI7), mRNA AMi 30281 Homo sapiens cDNA FLJ26771 fis, clone PRS03189 148.34 Down NM_003238 Homo sapiens transforming growth factor, beta 2 (TGFB2), mRNA BU734212 UI-E-CQ1 -agd-e-21 -0-Ulsi UI-E- OQi Homo sapiens cDNA clone UI- E-CQ1-agd-e-21-0-UI 3, mRNA sequence BM993 116 UI-H-DT0-aty-f-1 7-0-U I si NCICGAPDTO Homo sapiens cDNA clone IMAGE:5866000 3, mRNA sequence BX648964 Homo sapiens mRNA;, cDNA DKFZp686JO1 56 (from clone DKFZp686JO1 56) A1765021 wh56c02.xl NOICGAPKidll Homo sapiens cDNA clone IMAGE:2384738 3, mnRNA sequence D29453 HUMNK566 Human epidermal keratinocyte Homo sapiens cDNA clone 566, mRNA sequence 139.18 Down 135.35 Down 134.03 Down 133.35 Down 131.86 Down 128.83 Down 6.10OE-05 7.OOE-05 7.49E-05 8.59E-05 1.19E-04 6.22E-05 6.30E-05 24/05/06,15735 speci gp,78 79 NM_002521 BX1 02632 NM_024508 NM_1 53026 NM_006228 NM_005560 NM_023942 Homo sapiens natriuretic peptide precursor B (NPPB), mRNA BX1 02632 NCICGAPCo3 Homo sapiens cDNA clone IMAGp998J052307; IMAGE:928228, mRNA sequence Homo sapiens zinc finger, BED domain containing 2 (ZBED2), mRNA Homo sapiens prickle-like 1 (Drosophila) (PRICKLElI), mRNA Homo sapiens prepronociceptin (PNOC), mRNA Homo sapiens laminin, alpha 5 mRNA Homo sapiens hypothetical protein MGC3036 (MGC3036), mRNA 128.09 Down 123.34 Down 118.4 Down 106.78 Down 102.73 Down 99.24 Down 91.38 Down 1 .42E-04 1.15 E-04 5.18E-05 6. 1OE-05 2.87E-04 7.49E-05 6.30E-05 AK096481 Homo sapiens cDNA FLJ39162 fis, clone OCBBF2002376 A1335277 tb29h06.xl NCI_CGAP_Kidl2 Homo sapiens cDNA clone IMAGE:2055803 3, mRNA sequence BF798098 RC1-CI0045-021000-021-f02 C10045 Homo sapiens cDNA, mRNA sequence AK023631 Homo sapiens cDNA FLJ 13569 fis, clone PLACE 1008369 85.12 Down 84.58 Down 81.7 Down 7.45E-05 6.22E-05 8.59E-05 77.57 Down 77.16 Down 7.OOE-05 2.21 E-04 NM_000927 Homo sapiens ATP-binding cassette, sub-family B (MDRITAP), member 1 (ABCB1), mRNA BG197054 RST16291 Athersys RAGE Library 76.09 Down 1 .03E-04 24/05/06,15735 speci gp, 79 Homo sapiens cDNA, mRNA sequence AK058012 Homo sapiens cDNA FLJ25283 fis, clone STM06716 75.4 Down 70.8 Down 6.22E-05 6.24E-05 NM_000104 NM_004617 NM_000990 NM_002899 NM_000582 NM_002423 Homo sapiens cytochrome P450, family 1, subfamily B, polypeptide 1 (CYPiBi), mRNA Homo sapiens transmembrane 4 superfamily member 4 (TM4SF4), mRNA Homo sapiens ribosomal protein L27a (RPL27A), mRNA Homo sapiens retinol binding protein 1, cellular (RBP1), mRNA Homo sapiens secreted phosphoprotein 1 (osteopontin, bone sialoprotein 1, early T-lymphocyte activation 1) (SPP1), mRNA Homo sapiens matrix metal loprotei nase 7 (matrilysin, uterine) (MMP7), mRNA 63.32 Down 1 .39E-04 62.1 Down 62.01 Down 60.53 Down 60.01 Down 5.32E-05 2.87E-04 1. 18E-04 1 .56E-04 H89053 yw24c06.rl Morton Fetal Cochlea Homo sapiens cDNA clone IMAGE:253162 5, mRNA sequence AK090808 Homo sapiens cDNA FLJ33489 fis, clone BRAMY2003585 59.02 Down 58.15 Down 7.45E-05 7.49E-05 NM_001200 NM_001453 Homo sapiens bone morphogenetic protein 2 (BMP2), mRNA Homo sapiens forkhead box C1 (FOXCi), mRNA 57.05 Down 56.24 Down 56.11 Down 6.24E-05 6.10E-05 2.55E-04 AK092245 Homo sapiens cDNA FLJ34926 fis, 24/05/06,15735 speci -81 NM_005329 A1244954 NM_003287 BF696790 NM_001 202 clone NT2RP700331 9, highly similar to Mus musculus neuralin mRNA Homo sapiens hyaluronan synthase 3 (HAS3), transcript variant 1, mRNA cij93hO5.xl NCICGAPKid3 Homo sapiens cDNA clone IMAGE: 1867065 3, mRNA sequence Homo sapiens tumor protein 052like 1 (TPD52L-1), transcript variant 1, mRNA 602125323171 NIHMGC_56 Homo sapiens cDNA clone IMAGE:4282540 5, mRNA sequence Homo sapiens bone morphogenetic protein 4 (BMP4), transcript variant 1, mRNA 55.44 Down 54.38 Down 53.91 Down 49.46 Down 47.81 Down 7.22E-05 6.22E-05 7.45E-05 1.09E-04 8.21 8C042028 Homo sapiens, clone IMAGE:4794726, mRNA 47.5 Down 43.28 Down 7.49E-05 7.28E-05 AL833276 NM_1 84087 NM_003494 NM_024422 Homo sapiens mRNA; cDNA DKFZp451 D088 (from clone DKFZp451 D088) Homo sapiens tripartite motifcontaining 55 (TRIM55), transcript variant 4, mRNA Homo sapiens dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive) (DYSF), mRNA Homo sapiens desmocollin 2 (DSC2), transcript variant Dsc2a, mRNA 42.9 Down 42.2 Down 41.3 Down 41.1 Down 7.42E-05 7.31 1 .96E-04 1 .50E-04 A1249696 aj64a03.xl NCICGAPKid3 Homo 24/05/06,15735 speci gp,81 82 AL8331 66 NM_173505 NM_130435 NM_016356 AF31 8382 NM_018265 NM_152487 sapiens cDNA clone IMAGE:1864204 3, mRNA sequence Homo sapiens mRNA; cDNA DKFZp686I2118 (from clone DKFZp68621 18) Homo sapiens ankyrin repeat domain 29 (AN KRD29), mRNA Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript variant 2, mRNA Homo sapiens doublecortin domain containing 2 (DCDC2), mRNA Homo sapiens pp9974 mRNA, complete cds Homo sapiens hypothetical protein FLJ10901 (FLJ1O9O1), mRNA Homo sapiens hypothetical protein FLJ31842 (FLJ31842), mRNA 39.95 Down 39.16 Down 39.16 Down 38.33 Down 38.03 Down 37.23 Down 1 .89E-04 9.13E-05 2.54E-04 2.10E-04 8.59E-05 1.50E-04 1 .56E-04 2.21 E-04 2.09E-03 7.49E-05 6.22E-05 37 Down AK000075 Homo sapiens cDNA FLJ20068 fis, clone COL01755 NM_012464 NM_184087 BU680661 Homo sapiens tolloid-like 1 (TLL1), mRNA Homo sapiens tripartite motifcontaining 55 (TRIM55), transcript variant 4, mRNA UI-CF-DUI-aaz-f-04-0-UI.sl UI-CF- DUl Homo sapiens cDNA clone UI- CF-DU1-aaz-f-04-0-UI 3, mRNA sequence 7o18c06.xl NCICGAPKidll Homo sapiens cDNA clone 35.55 Down 35.05 Down 34.38 Down 34.34 Down BF431030 34.25 Down 1.86E-04 24/05/06,15735 spei gp, 82 83 NM_006722 NM_1 52284 BC037316 NM_002345 NM_080743 NM_004221 NM_004496 AA738254 BC045828 NM_000599 AF055376 IMAGE:3574283 3, mRNA sequence Homo sapiens microphthalmiaassociated transcription factor (MITE), transcript variant 3, mRNA Homo sapiens Snf7 homologue associated with Alix 3 (Shax3), mRNA Homo sapiens, clone IMAGE:5259432, mRNA Homo sapiens lumican (LUM), mRNA Homo sapiens serine-arginine repressor protein (35 kDa) mRNA Homo sapiens natural killer cell transcript 4 (NK4), mRNA Homo sapiens forkhead box Al (FOXAl), mRNA nxl3bO2.sl NCICGAPGC3 Homo sapiens cDNA clone IMAGE:1255947 3, mRNA sequence Homo sapiens zinc finger protein 608, mRNA (cDNA clone IMAGE:5262896), partial cds Homo sapiens insulin-like growth factor binding protein 5 mRNA Homo sapiens short form transcription factor C-MAF (c-maf) mRNA, complete cds 34.23 Down 33.99 Down 33.46 Down 33.34 Down 32.96 Down 32.74 Down 32.31 Down 32.23 Down 32.18 Down 32.18 Down 31.81 Down 6.30E-05 7.71 2.03 E-04 8.46E-05 5.23E-05 1 .45E-04 2.57E-04 6.1IOE-05 7.49E-05 9.81 2.01 E-04 NM_015236 Homo sapiens latrophilin 3 (LPHN3), 31.68 Down 9.69E-05 24/05/06,15735 speci gp,83 84 INO Ct mRNA NM_007069 BG221364 A18 19186 BF51 2544 Homo sapiens HRAS-Iike suppressor 3 (HRASLS3), mRNA RST41 175 Athersys RAGE Library Homo sapiens cDNA, mRNA sequence wj32dlO.xl NCICGAPKidl2 Homo sapiens cDNA clone IMAGE:2404531 3, mRNA sequence UI-H-BW1 -amf-c-08-0-U I.sl NCICGAPSub7 Homo sapiens cDNA clone IMAGE:3069687 3, mRNA sequence Homo sapiens leucine rich repeat neuronal 1 (LRRN1), mRNA UI-H-FE1 -beg-p-18-0-UI.sl NCICGAPFEI Homo sapiens cDNA clone U I-H-EEl -beg-p-i 3, mRNA sequence 31.67 Down 31.63 Down 31.49 Down 7.49E-05 2.22E-04 1 .80E-04 30.8 Down 7.49E-05 NM_020873 CA425961 30.67 Down 30.15 Down 2. 01 E-04 1 .88E-04 AK000776 Homo sapiens cDNA FLJ20769 fis, clone C0L06674 NM_001 562 NM_014333 NM_030583 Homo sapiens interleukin 18 (interferon-gamma-inducing factor) (11-18), mRNA Homo sapiens immunoglobulin superfamily, member 4 (IGSF4), mRNA Homo sapiens matrilin 2 (MATN2), transcript variant 2, mRNA 30.11 Down 29.97 Down 29.77 Down 29.05 Down 28.93 Down 1. 15E-04 7.65E-04 5.82E-04 8.46E-05 6.22E-05 W93585 zd9SgOl.sl Soares-fetal-heartNbHH 19W Homo sapiens cDNA clone 24/05/06,15735 spcci gp.S4 85 NM_012198 NM_001448 IMAGE:357264 3, mRNA sequence Homo sapiens grancalcin, EF-hand calcium binding protein (GCA), mRNA Homo sapiens glypican 4 (GPC4), mRNA 28.84 Down 28.72 Down 9.13E-05 6. 36E-04 AK056882 Homo sapiens cDNA FLJ32320 fis, clone PROST2003537 28.6 Down AB033048 NM_025074 NM_019000 BU729783 NM_004862 Homo sapiens mRNA for KIAA1 222 protein, partial cds Homo sapiens Fraser syndrome 1 (FRASi), transcript variant 1, mRNA Homo sapiens hypothetical protein FLJ20152 (FLJ2O152), mRNA UI-E-CKI-afh-h-18-0-UI.sl UI-E- CK1 Homo sapiens cDNA clone UI- E-CK1-afh-h-18-0-UI 3, mRNA sequence Homo sapiens Iipopolysaccharideinduced TNF factor (LITAF), mRNA 28.27 Down 28.13 Down 27.54 Down 26.13 Down 25.95 Down 25.67 Down 25.58 Down 4.45E-04 2.41 E.-04 8.92 1 .07E-04 6. 30E-05 8.99E-05 AB0l 1539 Homo sapiens mRNA for MEGF6 protein (KIAA0815), partial cds BC043195 Homo sapiens cDNA clone IMAGE:5288757, partial cds 3.12E-04 2.22E-04 NM_1 52864 AK1 25608 Homo sapiens chromosome 20 open reading frame 58 (C20orf58), mRNA Homo sapiens cDNA FLJ43620 fis, clone SPLEN2O217O1, highly similar to HLA CLASS I HISTOCOMPATIBILITY ANTIGEN, A-2 ALPHA CHAIN PRECURSOR 25.35 Down 25.33 Down 3.00 E-04 2.03E-04 24/05/06,15735 speci -86- AL080103 NM_173549 BG211832 NM_024726 NM_002559 NM_018168 Homo sapiens mRNA; cDNA DKFZp564N2216 (from clone DKFZp564N2216) Homo sapiens hypothetical protein FLJ39553 (FLJ39553), mRNA RST31404 Athersys RAGE Library Homo sapiens cDNA, mRNA sequence Homo sapiens IQ motif containing with AAA domain (IQCA), mRNA Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 3 (P2RX3), mRNA Homo sapiens chromosome 14 open reading frame 105 (C14orf105), mRNA Homo sapiens insulin-like growth factor binding protein 5 mRNA Homo sapiens non-metastatic cells protein expressed in (nucleosidediphosphate kinase) (NME5), mRNA Homo sapiens protein kinase (cAMP-dependent, catalytic) inhibitor beta (PKIB), transcript variant 3, mRNA Homo sapiens metallothionein 1F (functional) (MT1F), mRNA Homo sapiens hypothetical protein FLJ10847 (FLJ10847), mRNA xf67d04.x1 NCI_CGAP_Gas4 Homo sapiens cDNA clone 25.17 Down 24.71 Down 24.57 Down 24.08 Down 24.04 Down 23.69 Down 2.03E-04 1.67E-04 1.02E-04 7.49E-05 2.63E-04 1.50E-04 NM_000599 23.5 Down 4.02E-04 NM_003551 NM_032471 NM_005949 NM_018242 AW151660 23.23 Down 22.83 Down 22.22 Down 1.41E-04 1.54E-04 8.81E-05 22.1 Down 2.03E-04 21.81 Down 2.71E-04 24/05/06,15735 spcci gp.86 87 IMAGE:26231 11 3, mRNA sequence AK096975 Homo sapiens cDNA FLJ39656 fis, clone SMINT2005956 CA306881 NM_016212 NM_1 78470 NM_014243 U l-H-FT1 -bht-n-22-0-UI. s1 NCICGAPFT1 Homo sapiens cDNA clone Ul-H-FT1-bht-n-22-0-UI 3, mRNA sequence Homo sapiens TP53TG3 protein (TP53TG3), mRNA Homo sapiens WD repeat domain (WDR4OB), mRNA Homo sapiens a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3 (ADAMTS3), mRNA 21.78 Down 21.69 Down 21.67 Down 21.63 Down 21.47 Down 2.52 E-04 1 .30E-04 9.03E-05 7.59E-05 8.24E-05 AK1 26467 Homo sapiens cDNA FLJ44503 fis, clone UTERU3001 158 21.42 Down 21.37 Down 6.22E-05 1.23E-04 AW24851 6 2820632.3prime NIHMGC_7 Homo sapiens cDNA clone IMAGE:2820632 3, mRNA sequence NM_001263 Homo sapiens CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1 (CDS1), mRNA 21.12 Down 1. 1OE-04 BM669002 UI-E-CK1-afn-m-04-0-UI.s2 UI-E- CK1 Homo sapiens cDNA clone UI- E-CK1-afn-m-04-0-UI 3, mRNA 20.96 Down 7.28E-05 sequence NM_000170 Homo sapiens glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P) (GLDC), 20.78 Down 1. 19E-04 24/05/06,15735 speci gp,87 88 mRNA NM_014585 NM_031426 BM728728 NM_1 52369 NM_175056 NM_004524 Homo sapiens solute carrier family (iron-regulated transporter), member 1 (SLC4OA1), mRNA Homo sapiens chromosome 9 open reading frame 58 (C9orf58), transcript variant 1, mRNA UI-E-EO1 -aiv-c-02-0-U In1 UI-E-EO1 Homo sapiens cDNA clone UI-E- EO1-aiv-c-02-0-UI 5, mRNA sequence Homo sapiens hypothetical protein MGC45474 (MGC45474), mRNA Homo sapiens hypothetical protein L0C131368 (L0C131368), mRNA Homo sapiens lethal giant larvae homolog 2 (Drosophila) (LLGL2), mRNA 20.73 Down 20.62 Down 20.59 Down 20.57 Down 20.51 Down 8.46E-05 2.00 E-04 1.14E-04 9.78E-05 5.42E-04 20.3 Down 7.45E-05 A1436290 th8lc~l.xl Soares_NhHMPu_Si Homo sapiens cDNA clone IMAGE:2 125056 3, mRNA sequence AW268540 xv~lelO.xl NClCGAPLu28 Homo sapiens cDNA clone IMAGE:2816682 3, mRNA sequence BC015159 Homo sapiens cDNA clone IMAGE:3885734, partial cds 19.93 Down 19.89 Down 19.47 Down 19.43 Down 19.41 Down 1.23E-04 1 .09E-04 7.49E-05 2.83E-04 1. 01 E-04 NM_020130 BM979825 Homo sapiens chromosome 8 open reading frame 4 (CUorf4), mRNA UI-CF-DU1-adt-f-12-0-UI.s1 UI-CE- DUl Homo sapiens cDNA clone UI- CF-DU1-adt-f-12-0-UI 3, mRNA sequence 24/05/06.15735 speci gp,S8 89 BM7 12072 CB1 35276 UI-E-DW1-ahc-b-1 1-0-UI.rl UI-E- DWI Homo sapiens cDNA clone UI- E-DW1-ahc-b-1 1-0-UI 5, mRNA sequence K-EST0187371 L5HLK1 Homo sapiens cDNA clone L5HLK1-32- B1 2 5, mRNA sequence 19.33 Down 18.98 Down 1.19E-04 8.97E-05 T53523 ya89h12.rl Stratagene placenta (#937225) Homo sapiens cDNA clone IMAGE.68903 5, mRNA sequence 18.87 Down 1.96E-04 NM_138432 NM_023915 NM_017549 BG436244 Homo sapiens serine dehydrataselike (SDSL), mRNA Homo sapiens G protein-coupled receptor 87 (GPR87), mRNA Homo sapiens upregulated in colorectal cancer gene 1 (UCC 1), mRNA 602508665F1 NIHMGC_79 Homo sapiens cDNA clone IMAGE:4605617 5, mRNA sequence Homo sapiens hypothetical protein FLJ22457 (FLJ22457), mRNA Homo sapiens HERV-H LTRassociating 1 (HHLA1), mRNA Homo sapiens FLJ46072 protein (FLJ46072), mRNA Homo sapiens ankyrin repeat domain 2 (stretch responsive muscle) (AN KRD2), mRNA 18.84 Down 18.74 Down 18.73 Down 1.32E-04 2.72E-04 8.83E-05 18.7 Down 1 .49E-04 NM_024901 NM_005712 NM_198488 NM_020349 18.68 Down 18.63 Down 18.58 Down 18.49 Down 1.35E-04 1 .08E-04 7.49E-05 2.OOE-04 NM_002148 Homo sapiens homeo box D10 18.41 Down 3.05E-05 24/05/06,15735 speci gp,89 mRNA N78460 yz76h06.r1 Soares_multiple_sclerosis_2NbHMS P Homo sapiens cDNA clone IMAGE:289019 5, mRNA sequence 18.4 Down 4.02E-04 NM_006598 BF431041 Homo sapiens solute carrier family 12 (potassium/chloride transporters), member 7 (SLC12A7), mRNA nab31g02.x1 SoaresNSF F8 9W OT PAP S1 Homo sapiens cDNA clone IMAGE:3267627 3, mRNA sequence 18.13 Down 18.11 Down 8.59E-05 6.10E-05 AK126467 Homo sapiens cDNA FLJ44503 fis, clone UTERU3001158 17.84 Down 1.31E-04 NM_182487 Homo sapiens olfactomedin-like 2A (OLFML2A), mRNA 17.77 Down 1.06E-04 AK058012 Homo sapiens cDNA FLJ25283 fis, clone STM06716 17.76 Down 8.82E-05 NM_001252 NM_006252 NM_030899 NM_006722 AK056431 Homo sapiens tumor necrosis factor (ligand) superfamily, member 7 (TNFSF7), mRNA Homo sapiens protein kinase, AMPactivated, alpha 2 catalytic subunit (PRKAA2), mRNA Homo sapiens zinc finger protein 323 (ZNF323), mRNA Homo sapiens microphthalmiaassociated transcription factor (MITF), transcript variant 3, mRNA Homo sapiens cDNA FLJ31869 fis, clone NT2RP7002151 17.71 Down 17.63 Down 17.62 Down 17.53 Down 17.29 Down 2.46E-04 6.57E-04 1.77E-04 1.61E-04 8.46E-05 24/05/06,15735 spcci -91 BM71 9937 NM_005855 Ul-E-EJO-ahu-a-10-0-UI.rl UI-E-EJO Homo sapiens cDNA clone UI-E- EJ0-ahu-a-10-0-UI1 5, mRNA sequence Homo sapiens receptor (calcitonin) activity modifying protein 1 (RAMPi), mRNA INO AK124873 Homo sapiens cDNA FLJ42883 fis, clone BRHIP3006683 17.11 Down 16.97 Down 16.87 Down 16.61 Down 16.54 Down 16.47 Down 4.37E-05 1.56E-04 3.99E-04 6.12E-04 6.I1OE-05 1 .49E-04 NM_001977 AK074181 NM_000557 Homo sapiens glutamyl aminopeptidase (aminopeptidase A) (ENPEP), mRNA Homo sapiens mRNA for FLJ00254 protein Homo sapiens growth differentiation factor 5 (cartilage-derived morphogenetic protein-I) mRNA AK026966 Homo sapiens cDNA: FLJ23313 fis, clone HEP1 1919 BX1I13319 BX1 13319 NCICGAPGas4 Homo sapiens cDNA clone IMAGp998G205398; IMAGE:2184619, mRNA sequence AK055362 Homo sapiens cDNA FLJ30800 fis, clone FEBRA2001197 16.36 Down 16.19 Down 16.02 Down 8.92E-05 6.30E-05 3.05E-05 NM_021102 NM_002354 Homo sapiens serine protease inhibitor, Kunitz type, 2 (SPINT2), mRNA Homo sapiens tumor-associated calcium signal transducer 1 (TACSTD1), mRNA 15.94 Down 15.93 Down 2.71 E-04 9.1 3E-05 24/05/06,15735 speci gp,91 92 BQ003401 NM_033641 UI-H-EI 1 -azd-j-23-0-U Isi NCICGAPEi Homo sapiens cDNA clone IMAGE:5847286 3, mRNA sequence Homo sapiens collagen, type IV, alpha 6 (COL4A6), transcript variant B, mRNA 15.78 Down 15.77 Down 6.30E-05 5.35E-05 N38753 yy42dOl.sl Soares melanocyte 2NbHM Homo sapiens cONA clone IMAGE:273889 3, mRNA sequence 15.77 Down 3.67E-05 A1420213 te92g09.xl NCICGAPPr28 Homo sapiens cDNA clone IMAGE:2094208 3, mRNA sequence 15.7 Down 2.35E-04 AK095776 Homo sapiens cDNA FLJ38457 fis, clone FEBRA2020400 15.48 Down 15.33 Down 3.04E-04 6.10E-05 NM_006378 Homo sapiens sema domain, immunoglobulin domain (1g), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D (SEMA4D), mRNA AK021801 Homo sapiens cDNA FLJ 11739 fis, clone HEMBA1 005497 15.33 Down 1 .38E-04 BX538226 NM_001847 NM_017640 NM_007072 Homo sapiens mRNA; cDNA DKFZp686E1944 (from clone DKFZp686E1 944) Homo sapiens collagen, type IV, alpha 6 (COL4A6), transcript variant A, mRNA Homo sapiens leucine rich repeat containing 16 (LRRC 16), mRNA Homo sapiens HERV-H LTRassociating 2 (HHLA2), mRNA 15.23 Down 15.22 Down 15.21 Down 15.04 Down 2.37E-04 7.42E-05 6.39E-05 1.06E-04 24/05/06,15735 speci gp.92 93 NM_052947 NM_005139 Homo sapiens heart aipha-kinase (HAK), mRNA Homo sapiens annexin A3 (ANXA3), mRNA 14.96 Down 14.95 Down 2.23E-04 6.71 N63415 yy60dO4.sl Soares multiple_sclerosis_2NbHMS P Homo sapiens cDNA clone IMAGE:277927 3 similar to contains L1.b3 Li repetitive element;, mRNA 14.79 Down 2.23E-05 sequence BC052289 NM_153715 NM_014936 NM 021192 BXI 18238 NM_024969 Homo sapiens carboxypeptidase A4, mRNA (cDNA clone MGC:59749 IMAGE:6106874), complete cds Homo sapiens homeo box Al 0 (HOXA1 transcript variant 2, mRNA Homo sapiens ectonucleotide pyrophosphatase/phosphodiesteras e 4 (putative function) (EN PP4), mRNA Homo sapiens homeo box D1l1 (HOXD1 mRNA BX1 18238 NCI CGAP Kid3 Homo sapiens cDNA clone IMAGp998L1 53800; IMAGE: 1501598, mRNA sequence Homo sapiens TGF-beta induced apotosis protein 2 (TAIP-2), mRNA 14.76 Down 14.76 Down 14.67 Down 14.47 Down 14.44 Down 14.11 Down 7.22E-05 8.35E-05 8.19E-04 4.53E-04 5.07E-04 1 .57E-04 AK125490 Homo sapiens cDNA FLJ43501 fis, clone PEBLM2004497 R99527 yq79bl1 .sl Soares fetal liver spleen 1NFLS Homo sapiens cDNA clone 14.06 Down 13.98 Down 9.71 E-04 8.39E-04 24/05/06,15735 speci gp,93 94 NM_001873 NM_003761 NM_020808 NM_1 52573 NM_032866 BU740051 IMAGE:201981 3, mRNA sequence Homo sapiens carboxypeptidase E (CIPE), mRNA Homo sapiens vesicle-associated membrane protein 8 (endobrevin) (VAMP8), mRNA Homo sapiens signal-induced proliferation-associated 1 like 2 (SIPA1L-2), mRNA Homo sapiens RAS and EF hand domain containing (RASEF), mRNA Homo sapiens cingulin-like 1 (CGNL1), mRNA UI-E-EOO-ahw-n-1 8-0-UI si UI-E- EQO Homo sapiens cDNA clone UI- E-EOO-ahw-n-18-0-UI 3, mRNA sequence 13.91 Down 13.87 Down 13.84 Down 13.82 Down 13.78 Down 13.74 Down 9.16E-05 3.12E-04 5.47E-04 5.13E-04 6.30E-05 4.63E-04 NM_198389 Homo sapiens lung type-I cell membrane-associated glycoprotein (T1A-2), transcript variant 2, mRNA 13.71 Down 3.62E-04 CA777268 ipO5dO9.yl HR85 islet Homo sapiens cDNA clone IMAGE:61 34849 5, mRNA sequence 13.63 Down 1.39E-04 H00617 yj25f02.sl Soares placenta Nb2HP Homo sapiens cDNA clone IMAGE:149787 3, mRNA sequence 13.45 Down 3.33E-04 NM_024898 Homo sapiens family with sequence similarity 31, member C (FAM31 C), mRNA Homo sapiens collagen, type VI I, alpha 1 (epidermolysis bullosa, dystrophic, dominant and recessive) 13.39 Down 2.17E-03 NM_000094 13.3 Down 4.93E-04 24/05/06,15735 speci gp, 94 95 (COL7A), mRNA NM_002837 NM_018728 NM_018659 Homo sapiens protein tyrosine phosphatase, receptor type, B (PTPRB), mRNA Homo sapiens myosin VC (MYO5C), mRNA Homo sapiens cytokine-like protein C17 (C17), mRNA 13.25 Down 13.15 Down 13.11 Down 6.84E-04 1 .64E-04 1 .45E-04 AL834140 Homo sapiens mRNA; cDNA DKFZp434A2029 (from clone DKFZp434A2029) BX1 03476 BX103476 NCIOGAPLu5 Homo sapiens cDNA clone IMAGp998C053946; IMAGE:1557436, mRNA sequence BG545305 602572521 Fl NIHMGC_77 Homo sapiens cDNA clone IMAGE:4700644 5, mRNA sequence BX647876 Homo sapiens mRNA; cDNA DKFZp31 3A1 525 (from clone DKFZp31 3A1 525) 13.08 Down 13.02 Down 12.86 Down 12.83 Down 9.99E-05 1.71 E-04 6.30E-05 7.95E-05 NM_030949 NM_024423 Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 14C (PPP1R14C), mRNA Homo sapiens desmocollin 3 (DSC3), transcript variant Dsc3b, mRNA Homo sapiens tumor necrosis factor receptor superfamily, member 21 (TNFRSF21), mRNA Homo sapiens potassium channel, subfamily K, member 3 (KCNK3), 12.82 Down 12.81 Down 3.35E-04 7.71 NM_014452 12.8 Down 2.20E-04 NM_002246 12.76 Down 7.59E-05 24/05/06,15735 speci 96 mRNA NM_002427 NM_003328 NM_014422 NM_014333 AA888443 Homo sapiens matrix metal loprotei nase 13 (collagenase 3) (MMP13), mRNA Homo sapiens TXK tyrosine kinase (TXK), mRNA Homo sapiens phosphatidylinositol bisphosphate A (PIB5PA), transcript variant 1, mRNA Homo sapiens immunoglobulin superfamily, member 4 (IGSF4), mRNA nw74flO.sl NCICGAPPrl2 Homo sapiens cDNA clone IMAGE:1252363, mRNA sequence BX1 10418 NCI CGAP Kid3 Homo sapiens cONA clone IMAGp998C224149; IMAGE:1635405, mRNA sequence Homo sapiens homeo box A5 mRNA Homo sapiens CXXC finger 5 mRNA Homo sapiens plakophilin 2 (PKP2), transcript variant 2b, mRNA 12.65 Down 12.61 Down 12.48 Down 4.08E-04 2.45E-04 8.97E-05 12.4 Down 12.37 Down 1 .04E-04 3.96E-04 BX1I10418 NM_019102 NM_016463 NM_004572 12.35 Down 12.33 Down 12.32 Down 12.28 Down 12.27 Down 1 .54E-04 7.59E-05 1 .96E-04 4.15E-04 1.02E-04 N25875 yw78d12.sl Soares placenta_8to9weeks_2NbH P8to9W Homo sapiens cDNA clone IMAGE:258359 3, mRNA sequence NM_152694 Homo sapiens zinc finger, CCHC domain containing 5 12.22 Down 3. 38E-04 24/05/06,15735 spcij gp,%6 97 mRNA NM_021012 NM_017671 NM_002031 BM976385 Homo sapiens potassium inwardlyrectifying channel, subfamily J, member 12 (KCNJ 12), mRNA Homo sapiens chromosome 20 open reading frame 42 (C20orf42), mRNA Homo sapiens fyn-related kinase (FRK), mRNA UI-CF-EN1-acz-f-03-0-UI.sl UI-CE- ENi Homo sapiens cONA clone UI- CF-EN1I-acz-f-03-0-Ul 3, mRNA 12.22 Down 12.21 Down 12.11 Down 12.02 Down 9.23E-04 1.06E-04 2.14E-04 8.11 E-04 sequence NM_005296 NM_000817 A1220066 NM_005737 NM_000147 Homo sapiens G protein-coupled receptor 23 (GPR23), mRNA Homo sapiens glutamate dlecarboxylase 1 (brain, 67kDa) (GADi), transcript variant GAD67, mRNA qg84dOl .xl SoaresNFLTGBCSi Homo sapiens cDNA clone IMAGE: 1841857 3, mRNA sequence Homo sapiens ADP-ribosylation factor-like 7 (ARL7), mRNA Homo sapiens fucosidase, alpha-L- 1, tissue (FUCAl), mRNA 11.98 Down 11.92 Down 11.88 Down 11.83 Down 11.82 Down 11.82 Down 11.81 Down 1 .50E-04 6.22E-05 1.09E-04 1.58E-04 1.74E-03 1 .68E-04 AK127437 Homo sapiens cDNA FLJ45529 fis, clone BRTHA2027546 NM_1 78033 Homo sapiens cytochrome P450, family 4, subfamily X, polypeptide 1 (CYP4X1), mRNA 2.1 OE-04 24/05/06,15735 speci gp.9 7 98 NM_173567 AL049974 NM_000519 AL359567 BF51 0493 NM_000961 Homo sapiens abhydrolase domain containing 7 (ABHD7), mRNA Homo sapiens mRNA; cDNA DKFZp564B222 (from clone DKFZp564B222) Homo sapiens hemoglobin, delta (HBD), mRNA Homo sapiens mRNA; cDNA DKFZp547D023 (from clone DKFZp547D023) Ul-H-B14-apa-b-08-0-Ul .sl NCICGAPSub8 Homo sapiens cDNA clone IMAGE:3086558 3, mRNA sequence Homo sapiens prostaglandin 12 (prostacyclin) synthase (PTGIS), mRNA Homo sapiens RABi 1 family interacting protein 1 (class 1) (RABliFIPi), transcript variant 1, mRNA 11.76 Down 11.74 Down 11.7 Down 1 .75E-04 5.82E-04 9.70E-04 11.66 Down 11.66 Down 11.63 Down 3.95E-04 6.30E-05 5.06E-04 NM_025151 11.6 Down 11.6 Down 1.14E-04 9.48E-05 BM712945 UI-E-EJO-ahi-c-16-0-UI.rl UI-E-EJO Homo sapiens cDNA clone UI-E- EJO-ahi-c-16-0-UI 5, mRNA sequence AW451831 Ul-H-B13-alk-e-12-0-Ul.sl Homo sapiens cDNA clone IMAGE:2737246 3, mRNA sequence BC040701 Homo sapiens cDNA clone IMAGE:5736259, partial cds AL359058 Homo sapiens mRNA full length 11.54 Down 11.53 Down 11.44 Down 8.69E-04 1.23E-04 1 .27E-03 24/05/06,15735 speci gp,98 99 NM_001854 NM_000227 NM_033256 insert cDNA clone EUROIMAGE 592473 Homo sapiens collagen, type XI, alpha 1 (COLli1Al), transcript variant A, mRNA Homo sapiens laminin, alpha 3 (LAMA3), transcript variant 2, mRNA Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A), mRNA INO AB301 1538 Homo sapiens mRNA for MEGF5, partial cds AL389942 NM_174900 BG622707 NM_178177 AA099748 Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 2005635 Homo sapiens zinc finger protein 42 (ZFP42), mRNA 602647476F1 NIHMGC_79 Homo sapiens cDNA clone IMAGE:4768963 5, mRNA sequence Homo sapiens nicotinamide nucleotide adenylyltransferase 3 (NMNAT3), mRNA zl78c09.sl Stratagene colon (#937204) Homo sapiens cDNA clone IMAGE:510736 3, mRNA sequence 11.39 Down 11.39 Down 11.36 Down 11.35 Down 11.33 Down 11.23 Down 11.21 Down 11.19 Down 11.16 Down 7.56E-04 8.59E-05 1 .26E-04 4.81 E-04 4.78E-04 1 .29E-04 1.49E-04 3.57E-04 9.87E-05 H89526 yw28b04.rl Morton Fetal Cochlea Homo sapiens cDNA clone IMAGE:253519 5, mRNA sequence 11.06 Down 2.94E-04 NM_178868 Homo sapiens chemokine-like factor super family 8 (CKLFSF8), mRNA 10.96 Down 9.23E-04 24/05/06,15735 speci gp9 100- BE788763 NM_000076 NM_152768 601475864F1 NIHMGC_68 Homo sapiens cDNA clone IMAGE:3879014 5, mRNA sequence Homo sapiens cyclin-dependent kinase inhibitor 1C (p57, Kip2) (CDKN1C), mRNA Homo sapiens hypothetical protein FLJ25378 (FLJ25378), mRNA 10.88 Down 6.22E-05 M60502 Human profilaggrin mRNA, 3 end 10.87 Down 10.81 Down 10.81 Down 10.78 Down 10.77 Down 10.61 Down 7.28E-05 7.31 8.46E-05 1 .86E-03 3.32E-04 7.71 NM_181847 NM_005331 NM_032367 NM_004574 Homo sapiens amphoterin induced gene 2 (AMIGO2), mRNA Homo sapiens hemoglobin, theta 1 (HBQ1), mRNA Homo sapiens zinc finger, BED domain containing 3 (ZBED3), mRNA Homo sapiens peanut-like 2 (Drosophila) (PNUTL2), transcript variant 1, mRNA Homo sapiens dickkopf homolog 2 (Xenopus laevis) (DKK2), mRNA Homo sapiens zinc finger protein 452 (ZNF452), mRNA Homo sapiens sema domain, immunoglobulin domain short basic domain, secreted, (semaphorin) 3C (SEMA3C), mRNA Homo sapiens mRNA; cDNA DKFZp434N2O3O (from clone DKFZp434N2O3O) 10.6 Down 3.18E-04 NM_014421 NM_052923 NM_006379 AL1 37488 10.52 Down 10.43 Down 10.39 Down 10.37 Down 7.31 1 .06E-04 6.30E-05 2.60E-04 BX088936 BX088936 Soares-testisNHT 10.34 Down 1 .20E-03 24/05/06,15 735 speci gp,I100 101 Homo sapiens cONA clone 1MAGp998G123255; IMAGE: 1292195, mIRNA sequence AB041269 Homo sapiens mRNA for keratin 19, partial cds, isolate: K1 9-141 AK091933 Homo sapiens cDNA FLJ34614 fis, clone KIDNE2014268 AF269162 Homo sapiens c2l orf7 form B mRNA, complete cds 10.33 Down 10.3 Down 10.3 Down 10.27 Down 10.23 Down 4.02E-03 1.49E-04 1.78E-03 NM_001935 NM_001850 Homo sapiens dipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2) (DPP4), mRNA Homo sapiens collagen, type ViII, alpha 1 (COIL8A), transcript variant 1, mRNA 1.10E-04 2.23E-05 A1469032 ti7OaOl xl NCIOGAPKidi 1 Homo sapiens cDNA clone IMAGE:2137320 3, mRNA sequence 10.2 Down 7.42E-05 NM_003081 Homo sapiens synaptosomalassociated protein, transcript variant 1, mRNA 10.05 Down 2.34E-03 BG570144 602591134F1 NIHMGC_77 Homo sapiens cDNA clone IMAGE47 17761 5, mRNA sequence BM969191 UI-CF-ENO-acp-e-22-0-Ul.sl UI-CF- ENO Homo sapiens cDNA clone UI- CF-ENO-acp-e-22-0-UI 3, mRNA sequence 9.99 Down 9.99 Down 1 .09E-03 1 .OOE-03 NM_006622 Homo sapiens polo-like kinase 2 (Drosophila) (PLK2), mRNA 9.99 Down 1 .45E-04 24/05/06,15735 speci gp, 101 102 NM_000860 AJ318805 NM_002735 Homo sapiens hydroxyprostaglandin dehydrogenase 15-(NAD) (HPGD), mRNA AJ318805 Homo sapiens adipose tissue Homo sapiens cDNA clone 2040, mRNA sequence Homo sapiens protein kinase, cAMP-dependent, regulatory, type 1, beta (PRKARIB), mRNA 9.98 Down 9.97 Down 9.93 Down 9.91 Down 6.39E-05 1.92 E-04 8.51 E-06 1.57E-03 AK0921 14 Homo sapiens cDNA FLJ34795 fis, clone NT2NE2005921 NM_024608 Homo sapiens nei endonuclease VIII-like 1 coli) (NE11-l), mRNA BE464407 hx89g05.xl NCICGAPKidi 1 Homo sapiens cDNA clone IMAGE:31 95032 3, mRNA sequence BF431460 7o14b05.xl NCICGAPKidil Homo sapiens cDNA clone IMAGE:3573849 3, mRNA sequence BF509573 UI-H-B14-apf-b-1 1-0-U Isi NOICGAPSub8 Homo sapiens cDNA clone IMAGE:3086949 3, mRNA sequence T78754 ydOlfOB.rl Soares infant brain 1iNIB Homo sapiens cDNA clone IMAGE:24180 5, mRNA sequence 9.89 Down 9.88 Down 9.85 Down 9.82 Down 9.79 Down 3.05E-05 1 .05E-03 1.1 9E-03 2.57E-04 1. 51 E-03 NM_153256 NM_207482 Homo sapiens chromosome 10 open reading frame 47 (Cl Oorf47), mRNA Homo sapiens FLJ44048 protein (FLJ44048), mRNA 9.78 Down 9.76 Down 9.74 Down 2.10E-04 2.14E-04 3.70E-03 NM_002276 Homo sapiens keratin 19 (KRT19), 24/05/06,15735 speci gp, 102 103 INO mRNA N70752 za72d02.sl Soares-fetal-lungNbHL19W Homo sapiens cDNA clone IMAGE:298083 3, mRNA sequence NM_020962 Homo sapiens likely ortholog of mouse neighbor of Punc El 1 (NOPE), mRNA Homo sapiens serum/glucocorticoid regulated kinase 2 (SGK2), transcript variant 2, mRNA 9.73 Down 9.73 Down 9.7 Down 9.7 Down 1.49E-04 8.91 E-04 4.41 E-04 9.99E-05 NM_016276 A1355761 qt94all.xl NCI_CGAP_Col4 Homo sapiens cDNA clone IMAGE: 1962908 3 similar to gb:X74929 KERATIN, TYPE 11 CYTOSKELETAL 8 (HUMAN);, mRNA sequence NM_003264 NM_1 98495 Homo sapiens toll-like receptor 2 (TLR2), mRNA Homo sapiens CTAGE family, member 4 (CTAGE4), mRNA BX097888 BX097888 Soaresparathyroid-tumorNbHPA Homo sapiens cDNA clone IMAGp998K064187; IMAGE:1650173, mRNA sequence BU567804 AGENCOURT_10398872 NIHMGC_82 Homo sapiens cDNA clone IMAGE:6614502 5, mRNA sequence 9.69 Down 9.66 Down 9.62 Down 9.62 Down 1.86E-04 3.12E-04 6. 1OE-05 7.71 NM_152423 Homo sapiens melanoma associated antigen (mutated) 1 -like 1 (MUMILl), mRNA 9.61 Down 2.45E-03 24/05/06,1 5735 speci gp, 103 104 NM_018330 BU5841 97 NM_005264 NM_002245 NM_1 78550 NM_006863 NM_1 73354 Homo sapiens KIAA1 598 (KIAA1 598), mRNA 2513030T6 LIVRTUT04 Homo sapiens cDNA clone 2513030 3, mRNA sequence Homo sapiens GDNF family receptor alpha 1 (GFRA1I), transcript variant 1, mRNA Homo sapiens potassium channel, subfamily K, member 1 (KCNK1), mRNA Homo sapiens hypothetical protein MGC48998 (MGC48998), mRNA Homo sapiens leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1 (LILRA1), mRNA Homo sapiens SNFl-like kinase (SNF1LK), mRNA 9.6 Down 9.56 Down 9.56 Down 9.53 Down 9.51 Down 9.48 Down 9.47 Down 9.43 Down 9.38 Down 9.33 Down 9.31 Down 1.68E-04 8.83E-04 1.19E-04 2.05E-03 9.03E-04 6.22E-05 8.25E-04 2.15E-04 6.30E-05 1 .54E-04 1 .46E-04 BC016962 Homo sapiens, clone IMAGE:4182947, mRNA AB046810 Homo sapiens mRNA for KIAA1590 protein, partial cds BXI 16347 BU6331 63 BX1 16347 NCICGAPKidl 2 Homo sapiens cDNA clone IMAGp998B215967; IMAGE:2401844, mRNA sequence UI-H-FL1 -bgt-n-07-0-Ul si NCICGAPELI Homo sapiens cDNA clone UI-H-FL1-bgt-n-07-0-UI 3, mRNA sequence 24/05/06.15735 speci gp. 104 105 A1289329 BU951469 NM_002338 AL833346 qw28c09.xl NCICGAPUt4 Homo sapiens cDNA clone IMAGE: 1992400 3 similar to contains L1.b2 Li repetitive element ;mRNA sequence in6OaO5.x3 HR85 islet Homo sapiens cDNA clone IMAGE:6126249 3, mRNA sequence Homo sapiens limbic systemassociated membrane protein (LSAMP), mRNA Homo sapiens mRNA; cDNA DKFZp686M2234 (from clone DKFZp686M2234) 9.28 Down 9.21 Down 9.19 Down 9.17 Down 9.1 Down 4.80E-04 2.54E-03 1 .30E-03 3.02 E-04 1 .09E-03 BC040293 Homo sapiens, clone IMAGE:4820330, mRNA NM_003810 NM_014373 CA425405 Homo sapiens tumor necrosis factor (ligand) superfamily, member (TNFSF1O), mRNA Homo sapiens G protein-coupled receptor 160 (GPR16O), mRNA UI-H-FE1 -bef-g-08-0-UI .sl NCI_CGAP_FEl Homo sapiens cDNA clone UI-H-FE1-bef-g-08-0-UI 3, mRNA sequence 9.04 Down 9.01 Down 8.89 Down 8.87 Down 5.06E-04 1 .59E-04 1.74E-05 9.89E-03 A1953708 wq47d09.xl NOI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2474417 3, mRNA sequence NM_017641 NM_153377 Homo sapiens kinesin family member 21A (KIF21A), mRNA Homo sapiens leucine-rich repeats and immunoglobulin-like domains 3 8.86 Down 8.86 Down 7.22E-05 2.71 E-04 24/05/06,1573 5 speci gp.I105 106- (LRIG3), mRNA NM_000236 BC046362 Homo sapiens lipase, hepatic (LIPC), mRNA Homo sapiens voltage-dependent calcium channel gamma subunit-like protein, mRNA (cDNA clone MGC:50757 IMAGE:5221396), complete cds AJ697972 Homo sapiens chromosome 3 cDNA BF509074 NM_001080 NM_002247 NM_022154 NM_144707 UI-H-BI4-aou-b-08-0-UI.s1 NCI_CGAP_Sub8 Homo sapiens cDNA clone IMAGE:3086150 3, mRNA sequence Homo sapiens aldehyde dehydrogenase 5 family, member Al (succinate-semialdehyde dehydrogenase) (ALDH5A1), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA Homo sapiens potassium large conductance calcium-activated channel, subfamily M, alpha member 1 (KCNMA1), mRNA Homo sapiens solute carrier family 39 (zinc transporter), member 8 (SLC39A8), mRNA Homo sapiens prominin 2 (PROM2), mRNA 8.83 Down 8.8 Down 8.8 Down 8.8 Down 8.79 Down 8.78 Down 8.77 Down 8.73 Down 8.69 Down 1.93E-03 4.71 E-04 7.35E-04 1.24E-04 8.46E-05 7.45E-05 4.65E-05 2.01E-04 9.23E-04 AB095949 Homo sapiens mRNA for KIAA2029 protein AV728294 AV728294 HTC Homo sapiens cDNA clone HTCBIE09 5, mRNA 8.68 Down 8.46E-05 24/05/06,15735 speci gp.106 107sequence NM_003851 NM_014181 NM_000349 AK026740 Homo sapiens cellular repressor of ElA-stimulated genes 1 (CREGII), mRNA Homo sapiens HSPC159 protein (HSPC159), mRNA Homo sapiens steroidogenic acute regulator (STAR), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA Homo sapiens cDNA: FLJ23087 fis, clone LNG06994, highly similar to AF161368 Homo sapiens HSPC105 mRNA 8.68 Down 8.67 Down 8.66 Down 8.65 Down 8.63 Down 2.10E-04 1.10E-04 1.03E-04 7.45E-04 1.23E-04 T56535 yb33g07.rl Stratagene fetal spleen (#937205) Homo sapiens cDNA clone IMAGE:73020 5, mRNA sequence NM_178868 NM_005130 NM_032488 NM_052960 NM_207517 AK1 27644 Homo sapiens chemokine-like factor super family 8 (CKLFSF8), mRNA Homo sapiens fibroblast growth factor binding protein 1 (FGFBP1), mRNA Homo sapiens cornifelin (CNFN), mRNA Homo sapiens retinol binding protein 7, cellular (RBP7), mRNA Homo sapiens ADAMTS-like 3 (ADAMTSL3), mRNA Homo sapiens cDNA FLJ45742 fis, clone KIDNE2016327 8.63 Down 8.62 Down 8.6 Down 8.6 Down 8.57 Down 8.54 Down 6.22E-05 1. 15E-04 3.05E-05 2.05E-04 2.22E-04 3.24E-03 24/05/06,15735 speci gp. 107 -108- INO BU727096 UI-E-CRO-ach-e-12-0-Ul.sl UI-E- CRO Homo sapiens cDNA clone UI- E-CRO-ach-e-12-0-UI 3, mRNA sequence NM_015973 Homo sapiens galanin (GAL), mRNA NM_033514 NM_138811 NM_005302 NM_173462 NM_032148 NM_000856 AW591723 NM_032024 AK024850 NM_002206 Homo sapiens LIM and senescent cell antigen-like domains 3 (LIMS3), mRNA Homo sapiens chromosome 7 open reading frame 31 (C7orf31), mRNA Homo sapiens G protein-coupled receptor 37 (endothelin receptor type B-like) (GPR37), mRNA Homo sapiens papilin, proteoglycanlike sulfated glycoprotein (PAPLN), mRNA Homo sapiens solute carrier family 41, member 2 (SLC41A2), mRNA Homo sapiens guanylate cyclase 1, soluble, alpha 3 (GUCY1A3), mRNA xt85h10.x1 NCI_CGAP_Utl Homo sapiens cDNA clone IMAGE:2793283 3 similar to contains element MER32 repetitive element;, mRNA sequence Homo sapiens chromosome 10 open reading frame 11 (ClOorfl11), mRNA Homo sapiens cDNA: FLJ21197 fis, clone COL00201 Homo sapiens integrin, alpha 7 (ITGA7), mRNA 8.53 Down 8.53 Down 8.51 Down 8.47 Down 8.47 Down 8.46 Down 8.44 Down 8.37 Down 8.36 Down 8.25 Down 8.21 Down 8.2 Down 9.29E-04 6.30E-05 3.30E-04 8.35E-05 2.19E-03 1.70E-04 9.03E-05 1.17E-03 4.86E-04 1.80E-04 7.71E-05 6.30E-05 24/05/06,15735 speci gp,108 109 A1963999 NM_005567 wt87g07.xl NCIOGAPGC6 Homo sapiens cDNA clone IMAGE:2514492 3, mRNA sequence Homo sapiens lectin, galactosidebinding, soluble, 3 binding protein (LGALS3B3P), mRNA D87454 Human mRNA for KIAA0265 gene, partial cds 8.19 Down 8.18 Down 8.14 Down 8.12 Down 8.12 Down 8.12 Down 1.61 E-03 8.76E-05 1.08E-03 7.71 1 .46E-04 2.08 E-04 BG564960 NM_022168 602583930F1 NIHMGC_76 Homo sapiens cDNA clone IMAGE:4711807 5, mRNA sequence Homo sapiens interferon induced with helicase C domain 1 (IFIHi), mRNA AK027541 Homo sapiens cDNA FLJ 14635 fis, clone NT2RP2001 196 NM_024997 A1926616 Homo sapiens activating transcription factor 7 interacting protein 2 (ATF7IP2), mRNA wo48e04.xl NCICGAPGas,4 Homo sapiens cDNA clone IMAGE:2458590 3 similar to contains MER27.b2 MER27 repetitive element;, mRNA sequence 8.11 Down 8.08 Down 8.06 Down 1 .65E-03 6.30E-05 2.21 E-04 S70348 Homo sapiens integrin beta 3 mRNA, partial cds, alternatively spliced NM_005725 CA311343 Homo sapiens tetraspan 2 (TSPANmRNA Ul-CF-FNO-aff-b-19-0-UI.sl UI-CF- FNO Homo sapiens cDNA clone UI- 8.05 Down 8.02 Down 3.97E-03 8.51 E-06 24/05/06,15735 speci gp, 109 -110- NM_001710 NM_002247 BG149255 NM_1 53634 NM_004390 NM_016613 NM_001845 NM_005502 NM_018650 CF-FNO-aff-b-19-0-UI 3, mRNA sequence Homo sapiens B-factor, properdin mRNA Homo sapiens potassium large conductance calcium-activated channel, subfamily M, alpha member 1 (KCNMA1), mRNA nad25dOl xl NCI_CGAP_Lu24 Homo sapiens cDNA clone IMAGE:3366553 3, mRNA sequence Homo sapiens copine VIII (CPNE8), mRNA Homo sapiens cathepsin H (CTSH), transcript variant 1, mRNA Homo sapiens hypothetical protein DKFZp434L142 (DKFZp434L142), mRNA Homo sapiens collagen, type IV, alpha 1 (COL4A1), mRNA Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 1 (ABCA1I), mRNA Homo sapiens MAP/microtubule affinity-regulating kinase 1 (MARKII), mRNA 8.01 Down 8 Down 8 Down 7.97 Down 7.97 Down 7.97 Down 7.93 Down 7.93 Down 7.92 Down 7.92 Down 1 .30E-03 1 .29E-03 3.85E-04 3.57E-04 7.71 3.72E-04 8.65E-05 5.1 8E-04 1.23E-04 9.23E-04 062831 HUM33OB12B Clontech human aorta polyA+ mRNA (#6572) Homo sapiens cDNA clone GEN-330B12 mRNA sequence CA313095 UI-CF-FNO-aex-f-01-0-UI.sl UI-CF- FNO Homo sapiens cDNA clone UI- 7.91 Down 7.42E-04 24/05/06,15735 speci gp,l 110 -111I- CF-FNO-aex-f-01-0-UI 3, mRNA sequence BC038556 Homo sapiens, clone IMAGE:3446976, mRNA A1493349 tg7OfO4.xl Soares_NhHMPu_Si Homo sapiens cDNA clone IMAGE:21 14143 3, mRNA sequence BC015108 Homo sapiens, Similar to otoconin clone IMAGE:4044247, mRNA A1819863 wj45h05.xl NCI_CGAP_Lul9 Homo sapiens cDNA clone IMAGE:2405817 3, mRNA sequence BM802920 AGENCOURT_6457446 NIHMGC_88 Homo sapiens cDNA clone IMAGE:5560288 5, mRNA sequence AK057113 Homo sapiens cDNA FLJ32551 fis, clone SPLEN1 000087 7.91 Down 7.9 Down 7.9 Down 7.87 Down 7.85 Down 7.83 Down 2.57E-03 1 .14E-04 1.01 E-04 2.39E-03 1 .60E-03 1 .20E-03 NM_005025 AA195328 NM_014358 Homo sapiens serine (or cysteine) proteinase inhibitor, dlade I (neuroserpin), member 1 (SERPIN1l), mRNA zr34f08.sl Soares_NhHMPu_51 Homo sapiens cDNA clone IMAGE:.665319 3, mRNA sequence Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 9 (CLECSF9), mRNA 7.82 Down 7.81 Down 7.81 Down 7.8 Down 2.21 E-04 2.37E-04 5.03E-03 6.69E-04 81493986 dflO6gl2.yl Morton Fetal Cochlea Homo sapiens cDNA clone IMAGE:2538815 5, mRNA sequence 24105/06.15735 speci gp, I I I 112- INO Ct NM_1 52366 NM_015678 NM_018424 CA3 10979 NM_031476 NM_004086 NM_003617 BF966833 Homo sapiens keich/ankyrin repeat containing cyclin Al interacting protein (KARCA1), transcript variant 1, mRNA Homo sapiens neurobeachin (NBEA), mRNA Homo sapiens erythrocyte membrane protein band 4.1 like 4B (EPB41L1413), mRNA UI-CF-FNO-afc-c-21-0-UI.sl UI-CF- FNO Homo sapiens cDNA clone UI- CF-FNO-afc-c-21-0-UI 3, mRNA sequence Homo sapiens hypothetical protein DKFZp434BO44 (DKFZP434BO44), mRNA Homo sapiens coagulation factor C homolog, cochlin (Limulus polyphemus) (COCH), mRNA Homo sapiens regulator of G-protein signalling 5 (RGS5), mRNA 602286668T1 NIHMGC_95 Homo sapiens cDNA clone IMAGE:4375360 3, mRNA sequence 7.79 Down 7.78 Down 7.77 Down 7.76 Down 7.75 Down 7.74 Down 7.73 Down 7.73 Down 7.71 Down 7.71 Down 7.7 Down 7.69 Down 8.97E-05 2.12E-04 1.23E-04 1.86E-04 2.20E-03 2.21 E-04 3.85E-04 6.10E-05 1.13E-03 6.03E-04 1 .49E-04 2.39E-03 AK024270 Homo sapiens cDNA FLJ 14208 fis, clone NT2RP3003264 NM_144587 Homo sapiens chromosome 10 open reading frame 87 (ClOorf87), mRNA AK096288 Homo sapiens cDNA FLJ38969 fis, clone NT2RI2002359 BE968596 601649770F1 NIHMGC_74 Homo sapiens cDNA clone 24/05/06,15735 speci gp. 112 113- AY358775 BX1 03949 NM_013410 NM_005204 NM_032211 IMAGE:3933472 5, mRNA sequence Homo sapiens clone DNA170212 WGAR9166 (UNQ9166) mRNA, complete cds BX103949 NCICGAPCo3 Homo sapiens cDNA clone IMAGp998C112296; IMAGE:923842, mRNA sequence Homo sapiens adenylate kinase 3 (AK3), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA Homo sapiens mitogen-activated protein kinase kinase kinase 8 (MAP3K8), mRNA Homo sapiens lysyl oxidase-like 4 (LOXL4), mRNA 7.66 Down 7.64 Down 7.64 Down 7.63 Down 7.6 Down 7.57 Down 2.16E-03 3.1 8E-04 3.07E-04 6.82E-04 3.30E-04 6.30E-05 AA325746 EST28794 Cerebellum 11 Homo sapiens cDNA 5 end, mRNA sequence H94320 yvl18b10. sl1 Soares fetal liver spleen 1 NELS Homo sapiens cDNA clone IMAGE:243067 3, mRNA sequence BX640973 Homo sapiens mRNA; cDNA DKFZp686B15184 (from clone DKFZp686B15 184) BQ015616 UI-1 -BC1 -ajb-g-04-0-UI.sl NCIOGAPP12 Homo sapiens cDNA clone UI-1-BC1-ajb-g-04-0-UI 3, mRNA sequence AK128715 Homo sapiens cDNA FLJ46882 fis, clone UTERU301 5844 7.55 Down 7.55 Down 7.54 Down 7.53 Down 3.35E-03 7.89E-04 5.28 E-04 2.30E-04 24/05/06.15735 speci gp,I 113 -114- NM_015068 BU754480 Homo sapiens paternally expressed (PEGlO), mRNA UI-1-BBlp-axz-h-1 1-0-UIsi NCICGAPP16 Homo sapiens cDNA clone UI-1 -BB1 p-axz-h-1 UI 3, mRNA sequence 7.52 Down 7.49 Down 7.48 Down 7.48 Down 7.71 6.24E-04 1 .93E-03 1 .96E-04 AK074097 Homo sapiens mRNA for FLJO0168 protein BC033567 Homo sapiens, clone IMAGE4822266, mRNA NM_018894 BM701 989 NM_016423 BX1 17317 NM_001993 CA502991 A1686890 Homo sapiens EGF-containing fibulin-like extracellular matrix protein 1 (EFEMPi), transcript variant 2, mRNA UI-E-CQ1-aex-j-06-0-UI.rl UI-E- CQ1 Homo sapiens cDNA clone UI- E-CQ1-aex-j-06-0-UI 5, mRNA sequence Homo sapiens zinc finger protein 219 (ZNF219), mRNA BX1 17317 NCICGAPCo3 Homo sapiens cDNA clone IMAGp998E242234; IMAGE:900095, mRNA sequence Homo sapiens coagulation factor Ill (thromboplastin, tissue factor) (F3), mRNA UI-CF-FNO-afp-g-01-0-UI.sl UI-CF- FNO Homo sapiens cDNA clone UI- CF-FNO.-afp-g-01-0-UI 3, mRNA sequence tp9OhO2.xl NCICGAPUt3 Homo 7.47 Down 7.47 Down 7.46 Down 7.45 Down 7.45 Down 7.43 Down 7.41 Down 2.67E-04 4.53E-04 1.61 E-04 1.13E-03 5.82 E-04 2.24E-02 1 .49E-04 24/05/06,15735 speci gp.I 114 115 INO INO sapiens cDNA clone IMAGE:22066111 3, mRNA sequence AWl 37001 UI-H-Bl 1 -acu-c-05-0-UI si NCICGAPSub3 Homo sapiens cDNA clone IMAGE:2715632 3, mRNA sequence BQ02 1695 UI-H-DH 1-axi-f-22-0-UI.sl NCICGAPOHi Homo sapiens cDNA clone IMAGE:5829141 3, mRNA sequence BX640643 Homo sapiens mRNA; cDNA DKFZp686O241 14 (from clone DKFZp686O241 14) 7.4 Down 7.39 Down 7.36 Down 7.95E-05 6.10E-05 5.1 8E-05 NM_004669 NM_001955 Homo sapiens chloride intracellular channel 3 (CLIC3), mRNA Homo sapiens endothelin 1 (EDNi), mRNA AB007974 Homo sapiens mRNA, chromosome 1 specific transcript KIAA0505 NM_1 98174 BX098521 NM_004154 Homo sapiens transcription factor CP32-like 4 (TFCP2L4), transcript variant 3, mRNA BX098521 Soares fetal liver spleen 1 NFLS Homo sapiens cDNA clone IMAGp998L05118; IMAGE:123412, mRNA sequence Homo sapiens pyrimidinergic receptor P2Y, G-protein coupled, 6 (P2RY6), transcript variant 4, mRNA 7.35 Down 7.33 Down 7.33 Down 7.32 Down 7.3 Down 7.28 Down 7.27 Down 7.25 Down 4.30E-03 7.72E-04 5.29E-03 4.82E-03 5.51 E-03 3.41 E-03 2.26E-03 1.34E-03 AK123617 Homo sapiens cDNA FLJ4 1623 fis, clone CTONG3009227 BF1 11903 7138d07.xl 24/05/06,15735 speci gp,I 115 -116- NM_018655 NM_1 39161 BC060805 CA413744 NM_018986 NM_024677 ALl17454 AW450938 NM_017899 SoaresNSFF8_9WOTPAPSi Homo sapiens cDNA clone IMAGE:3523644 3, mRNA sequence Homo sapiens lens epithelial protein (LENEP), mRNA Homo sapiens crumbs homolog 3 (Drosophila) (CR833), transcript variant 2, mRNA Homo sapiens hypothetical protein FLJ 12788, mnRNA (cDNA clone IMAGE:5266931), partial cds UI-H-EZO-bat-h-1 2-0-Ul si NCICGAPChi Homo sapiens cDNA clone UI-H-EZO-bat-h-12-0-UI 3, mRNA sequence Homo sapiens SH3 domain and tetratricopeptide repeats 1 (SH3TC1), mRNA Homo sapiens hypothetical protein FLJ14001 (FLJI4001), mRNA Homo sapiens mRNA; cDNA DKFZp586J 1717 (from clone DKFZp586J 1717) U l-H-B13-all-g-05-0-Ul. sl Homo sapiens cDNA clone IMAGE:.2737329 3, mRNA sequence Homo sapiens hypothetical protein FLJ20607 (TSC), mRNA 7.24 Down 7.23 Down 7.22 Down 7.22 Down 7.21 Down 7.21 Down 7.2 Down 7.19 Down 7.16 Down 7.16 Down 1 .07E-04 8.46E-04 7.45E-05 6.09E-04 2.68E-03 1.14E-04 2.93E-04 1.19E-04 4.80E-03 8.76E-05 S81 734 tissue transglutaminase homologue {alternatively spliced) [human, erythroleukemnia cell line HEL 24/05/06,15735 speci gp.I 116 -117- BU61 6749 NM_006681 GMO6141A, mRNA, 2362 nt] UI-H-FH1-bfj-a-1 1-0-Ulsi NCICGAPFH1 Homo sapiens cDNA clone UI-H-FH1-bfj-a-1 3, mRNA sequence Homo sapiens neuromedin U (NMU), mRNA 7.14 Down 7.1 Down 7.09 Down 2.21 E-04 6.52E-03 1.15 E-04 AK022598 Homo sapiens cDNA EUJ 12536 fis, clone NT2RM4000265 AWl 37116 BX647876 NM_000597 UI-H-BI 1 -acp-f-03-0-UI.sl NCICGAPSub3 Homo sapiens cDNA clone IMAGE:2715029 3, mRNA sequence Homo sapiens mRNA;, cDNA DKFZp313A1 525 (from clone DKFZp31 3A1 525) Homo sapiens insulin-like growth factor binding protein 2, 36kDa (IGFBP2), mRNA 7.07 Down 7.06 Down 7.04 Down 7.04 Down 7.04 Down 3.50E-03 1.41 E-03 2.99E-03 1 .43E-03 3.55E-03 CN478597 U l-CF-FNO-aeo-g-21 -0-UI .sl U l-CF- ENO Homo sapiens cDNA clone UI- CF-FNO-aeo-g-21-0-UI 3, mRNA sequence CN478714 UI-CF-FNO-afu-c-19-0-UI.sl UI-CF- FNO Homo sapiens cDNA clone UI- CF-FNO-afu-c-19-0-UI 3, mRNA sequence AB020640 Homo sapiens mRNA for KIAA0833 protein, partial cds 7 Down NM_022746 A1905628 Homo sapiens hypothetical protein FLJ22390 (FLJ22390), mRNA CM-BT094-050299-147 BT094 6.99 Down 6.98 Down 2.45E-03 9.12E-04 1 .54E-04 24/05/06,15735 sptci gp, 117 118- NM_002193 NM_004490 NM_003985 NM_000480 Homo sapiens cDNA, mRNA sequence Homo sapiens inhibin, beta B (activin AB beta polypeptide) (INHBB), mRNA Homo sapiens growth factor receptor-bound protein 14 (GRB 14), mRNA Homo sapiens tyrosine kinase, nonreceptor, 1 (TNKI), mRNA Homo sapiens adenosine monophosphate deaminase (isoform E) (AMPD3), mRNA 6.96 Down 6.94 Down 6.93 Down 6.92 Down 6.92 Down AK094292 Homo sapiens cDNA FLJ36973 fis, clone BRACE2006249 BC033124 Homo sapiens, clone IMAGE:2960615, mRNA NM_000612 Homo sapiens insulin-like growth factor 2 (somatomedin A) (IGF2), mRNA BC042976 Homo sapiens cDNA clone IMAGE:5295023, partial cds 6.88 Down 6.88 Down 6.88 Down 6.87 Down 6.87 Down 6.84 Down 7.59E-04 1.98E-03 2.10E-04 1.06E-04 2.03E-03 7.22E-05 2.60E-04 2.39E-03 5.18E-04 3.18E-04 1 .45E-03 BF445031 NM_004170 NM_199169 nad2OfO2.xl NCICGAPLu24 Homo sapiens cDNA clone IMAGE:3366266 3, mRNA sequence Homo sapiens solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 (SLC1A1), mRNA Homo sapiens transmembrane, prostate androgen induced RNA (TMEPAI), transcript variant 2, 24/05/06,15735 speci gp,I 118 -119mRNA NM_019644 Homo sapiens ankyrin repeat domain 7 (ANKRD7), mRNA 6.83 Down 6.82 Down 8.99E-05 6.79E-03 W20132 zb4OclO.rl Soaresparathyroid-tumorNbHPA Homo sapiens cDNA clone IMAGE:306066 5, mRNA sequence BC0331 16 NM_018650 BU563992 ALI19769 NM_052997 NM_024704 NM_000495 BX1 02895 Homo sapiens chromodomain helicase DNA binding protein 7, mRNA (cDNA clone IMAGE:3352674), partial cds Homo sapiens MAP/microtubule affinity-regulating kinase 1 (MARKi), mRNA AGENCOURT_10371176 NIHMGC_141 Homo sapiens cDNA clone IMAGE:6601829 mRNA sequence DKFZp761EI224_rI 761 (synonym: hamy2) Homo sapiens cDNA clone DKFZp761E1224 5, mRNA sequence Homo sapiens ankyrin repeat domain 30A (AN KRD3OA), mRNA Homo sapiens chromosome 20 open reading frame 23 (C20orf23), mRNA Homo sapiens collagen, type IV, alpha 5 (Alport syndrome) transcript variant 1, mRNA BX1 02895 Soares fetal liver spleen 1 NFLS Homo sapiens cDNA clone IMAGp998118520; IMAGE:242009, 6.82 Down 6.8 Down 6.79 Down 6.78 Down 6.78 Down 6.76 Down 6.74 Down 6.7 Down 8.03E-05 4.97E-03 1 .29E-02 2.52E-03 2.45E-03 7.45 E-04 4.77E-03 3.04E-04 24/05/06,15735 speci gp, 119 120mRNA sequence BU753362 AA1 90552 NM_004024 NM_144650 NM_002800 NM_021977 UI-1 -1 -air-h-09-0-UI.sl Homo sapiens cDNA clone UI-1 -1311 -air-h-09-0-UI 3, mRNA sequence zp86bl 1 .sl Stratagene HeLa cell s3 937216 Homo sapiens cDNA clone IMAGE:627069 3, mRNA sequence Homo sapiens activating transcription factor 3 (ATF3), mRNA Homo sapiens alcohol dehydrogenase, iron containing, 1 (ADHFE1), mRNA Homo sapiens proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional protease 2) (PSMB9), transcript variant 1, mRNA Homo sapiens solute carrier family 22 (extraneuronal monoamine transporter), member 3 (SLC22A3), mRNA 6.7 Down 6.67 Down 6.66 Down 6.65 Down 6.63 Down 6.62 Down 6.62 Down 6.61 Down 6.61 Down 6.58 Down 7.42E-05 1 .26E-03 3.12E-03 1 .45E-04 1 .70E-04 2.05 E-03 4.65E-03 1.72E-03 5.66E-04 6.30E-05 AW516579 xqOlfO6.xl SoaresNHCeC-cervical-tumor Homo sapiens cDNA clone IMAGE:274861 1 3, mRNA sequence A1311296 ta48dlO.x2 NCI CGAP Lu25 Homo sapiens cDNA clone IMAGE:2047315 3, mRNA sequence BC040204 Homo sapiens, clone IMAGE:4821815, mRNA AA340011 EST45155 Fetal skin Homo sapiens 24/05/06,15735 speci gp, 120 121 INO NM_025044 8X1 11520 cDNA 5 end, mRNA sequence Homo sapiens bicaudal C homolog 1 (Drosophila) mRNA BX1 11520 Soares placenta NbHIP Homo sapiens cDNA clone IMAGp998L1 5208; IMAGE:141470, mRNA sequence UI-H-B13-ajz-f-09-0-UI si Homo sapiens cDNA clone IMAGE:2733473 3, mRNA sequence Homo sapiens chromosome 11 open reading frame 13 (Cl lorfl mRNA AW444925 NM_003475 AK124778 Homo sapiens cDNA FLJ42788 fis, clone BRAWH3007129 NM_024563 NM_002214 NM_178814 A1831068 NM_000186 NM_000216 NM_015478 Homo sapiens hypothetical protein FLJ14054 (FLJ14054), mRNA Homo sapiens integrin, beta 8 (ITGB8), mRNA Homo sapiens adaptor-related protein complex 1, sigma 3 subunit (APIS3), mRNA wj62d12.xl NCI_CGAP_Lul9 Homo sapiens cDNA clone IMAGE:2407415 3, mRNA sequence Homo sapiens complement factor H (CFH), mRNA Homo sapiens Kallmann syndrome 1 sequence (KALl), mRNA Homo sapiens l(3)mbt-like (Drosophila) (L3MBTL), transcript 6.57 Down 6.57 Down 6.52 Down 6.5 Down 6.48 Down 6.44 Down 6.43 Down 6.42 Down 6.41 Down 6.39 Down 6.37 Down 6.36 Down 6.30E-05 1 .70E-03 2.55E-03 5.88E-04 8.61 E-04 4.72E-03 8.46E-05 1 .78E-04 3.72E-04 1.74E-03 8.59E-05 7.22E-05 24/05/06,15735 speci gp,121 122 Ct variant 1, mRNA BX096609 NM_030970 BQ007085 BX096609 Soares retina N2b4HR Homo sapiens cDNA clone 1MAGp998L12439; IMAGE:221339, mRNA sequence Homo sapiens hypothetical protein MGC3771 (MGC3771), mRNA UI-H-EI1-azc-k-1 1-0-Ulsi NCI_CGAP_Ei Homo sapiens cDNA clone IMAGE:5846914 3, mRNA sequence 6.36 Down 6.34 Down 6.33 Down 6.33 Down 1.24E-03 1.69E-04 1.19E-04 6.61 E-03 BC039329 Homo sapiens, clone IMAGE:5267606, mRNA NM_001 165 NM_004165 NM_001928 NM_018670 NM_153229 AA91 2845 AK1 27437 Homo sapiens baculoviral lAP repeat-containing 3 (BIRC3), transcript variant 1, mRNA Homo sapiens Ras-related associated with diabetes (RRAD), mRNA Homo sapiens D component of complement (adipsin) mRNA Homo sapiens mesoderm posterior 1 (MESPi), mRNA Homo sapiens hypothetical protein FLJ33318 (FLJ3331 mRNA ol32a 12.sl SoaresNFLTGBCSI Homo sapiens cDNA clone IMAGE: 1525150 3, mRNA sequence Homo sapiens cDNA FLJ45529 fis, clone BRTHA2027546 6.33 Down 6.33 Down 6.32 Down 6.31 Down 6.31 Down 6.29 Down 6.28 Down 3.42E-03 4.68E-03 3.68E-03 5.76E-03 2.57E-03 1.13E-03 3.37E-04 24/05/06,15735 speci gp, 122 123 NM_020836 AL512697 NM_005211 Homo sapiens brain-enriched guanylate kinase-associated protein (K1AA1446), mRNA Homo sapiens mRNA; cDNA DKFZp547F1 34 (from clone DKFZp547F1 34) Homo sapiens colony stimulating factor 1 receptor, formerly Mcoonough feline sarcoma viral (vfins) oncogene homolog (CSF1 R), mRNA AK124776 Homo sapiens cDNA FLJ42786 fis, clone BRAWH3006761 NM_1 73662 NM_014391 NM_005860 NM_001 045 NM_002147 A1288404 NM_1 73584 Homo sapiens hypothetical protein L0C285533 (L0C285533), mRNA Homo sapiens ankyrin repeat domain 1 (cardiac muscle) (ANKRD1), mRNA Homo sapiens follistatin-like 3 (secreted glycoprotein) (FSTL3), mRNA Homo sapiens solute carrier family 6 (neurotransmnitter transporter, serotonin), member 4 (SLC6A4), mRNA Homo sapiens homeo box B5 mRNA qv89bOl xl NCICGAPUt2 Homo sapiens cDNA clone IMAGE: 1988713 3, mRNA sequence Homo sapiens hypothetical protein MGC45840 (MGC45840), mRNA 6.27 Down 6.25 Down 6.24 Down 6.2 Down 6.18 Down 6.18 Down 6.18 Down 6.17 Down 6.17 Down 6.16 Down 6.16 Down 6.60E-03 1.36E-03 5.07E-04 1. 15E-04 1 .05E-02 3.52E-03 5.23E-05 5.46E-03 1 .05E-04 3.74E-04 1 .32E-04 24/05/06.15735 speci gp, 1 2 3 124- N62729 yz76g05.sl Soares multiple-sclerosis_2NbHMS P Homo sapiens cDNA clone IMAGE:289016 3, mRNA sequence AK024238 Homo sapiens cDNA FLJ14176 fis, clone NT2RP20031 01 6.12 Down 6.11 Down 1.37E-03 9.69E-05 NM_001843 NM_1 52433 Homo sapiens contactin 1 (CNTNI), transcript variant 1, mRNA Homo sapiens kelch repeat and BTB (POZ) domain containing 3 (KBTBD3), transcript variant 1, mRNA BX6491 12 Homo sapiens mRNA; cDNA DKFZp686E02109 (from clone DKFZp686E02109) AA411988 zt65gll.sl Soares-testisNHT Homo sapiens cDNA clone IMAGE:727268 3, mRNA sequence R80806 yi94fOl.s1 Soares placenta Nb2HP Homo sapiens cDNA clone IMAGE: 146905 3, mRNA sequence 6.1 Down 6.1 Down 6.1 Down 6.09 Down 6.08 Down 4.80E-03 2.39E-03 2.24 E-04 1 .40E-03 1 .54E-04 NM_002843 NM_003979 AWl 29281 Homo sapiens protein tyrosine phosphatase, receptor type, J (PTPRJ), mRNA Homo sapiens G protein-coupled receptor, family C, group 5, member A (GPCR5A), mRNA xf23a03.xl NCICGAPKid8 Homo sapiens cDNA clone IMAGE:2618860 3 similar to gb:X58295_rnmal PLASMA GLUTATHIONE PEROXIDASE PRECURSOR (HUMAN);, mRNA 6.08 Down 6.06 Down 6.06 Down 6.54E-03 8.75E-03 1.70E-04 24/05/06.15735 speci gp, 12 4 125 sequence NM_015345 Homo sapiens dishevelled associated activator of morphogenesis 2 (DAAM2), mRNA 6.05 Down 6.05 Down 1 .09E-03 5.51 E-03 L07615 Human neuropeptide Y receptor Y1 (NPYY1) mRNA, exon 2-3 and complete cds NM_016179 Homo sapiens transient receptor potential cation channel, subfamily C, member 4 (TRPC4), mRNA Homo sapiens phospholipase C, beta 4 (PLCB4), transcript variant 2, mRNA 6.04 Down 8.59E-05 NM_182797 6.03 Down, 4.40E-04 AB032945 Homo sapiens mRNA for KIAA1 119 protein, partial cds CA444471 UI-H-DPO-avv-a-16-0-Ul.sl NCICGAPFsl Homo sapiens cDNA clone UI-H-DPO-avv-a-16-0-UI 3, mRNA sequence AMi 27421 Homo sapiens cDNA FLJ45513 fis, clone BRTHA2021450 AV736303 AV736303 CB Homo sapiens cDNA clone CBCAJD04 5, mRNA sequence BX537613 Homo sapiens mRNA; cDNA DKFZp686E1 1117 (from clone DKFZp686E11 1117) AB02321 1 Homo sapiens mRNA for KIAA0994 protein, partial cds 6.03 Down 6.02 Down 6.01 Down 6.01 Down 6 Down 5.99 Down 5.99 Down 1. 11 E-02 1 .02E-03 1 .60E-04 8.97E-05 4.89E-04 5.50E-04 2.48E-04 NM_018349 Homo sapiens multiple C2-domains with two transmembrane regions 2 (MCTP2), mRNA 24/05/06,15735 speci gp, 125 -126- NM_000087 BF93941 6 NM_013951 AW1 95474 Homo sapiens cyclic nucleotide gated channel alpha 1 (CNGA1), mRNA nad89cO2.xl NCICGAPPr28 Homo sapiens cDNA clone IMAGE:3410667 3, mRNA sequence Homo sapiens paired box gene 8 (PAX8), transcript variant PAX8B3, mRNA xn38g09.xl NCICGAPKidi 1 Homo sapiens cDNA clone IMAGE:2696032 3, mRNA sequence 5.98 Down 5.97 Down 5.97 Down 5.97 Down 5.94 Down 3.29E-03 9.03E-04 2.57E-03 1.68E-04 5.78E-03 R40050 yf68h07.sl Soares infant brain 1iNIB Homo sapiens cDNA clone IMAGE:27726 3, mRNA sequence NM_021 101 AA602964 NM_006255 NM_024103 Homo sapiens claudin 1 (CLDN1), mRNA no97c02.sl NCICGAPPr2 Homo sapiens cDNA clone IMAGE:1 1114754, mRNA sequence Homo sapiens protein kinase C, eta (PRKCH), mRNA Homo sapiens solute carrier family (mitochondrial carrier; phosphate carrier), member 23 (SLC25A23), mRNA 5.9 Down 5.9 Down 5.89 Down 5.89 Down 5.88 Down 2.60E-04 1 .23E-03 2.78E-04 7.42E-05 2.28E-02 AK093870 Homo sapiens cDNA FLJ36551 fis, clone TRACH20081 27 BE070450 QV4-BT0407-020300-1 22-d08 BT0407 Homo sapiens cDNA, mRNA sequence 5.85 Down 3.53E-04 24/05/06,15735 speci gp, 26 127- NM_003706 NM_023927 Homo sapiens phospholipase A2, group IVC (cytosolic, calciumindependent) (PLA2G4C), mRNA Homo sapiens HCV NS3transactivated protein 2 (NS3TP2), mRNA 5.85 Down 5.85 Down 5.84 Down 7.81 E-04 2.64E-03 7.70E-03 AF519622 Homo sapiens noncoding mRNA sequence NM_198582 Homo sapiens FLJ43374 protein (FLJ43374), mRNA AK026283 Homo sapiens cDNA: FLJ22630 fis, clone HS106250 CB1 15754 BQ1 88285 NM_003662 BX098660 NM_005360 NM_031847 K-EST0159876 L8SCKO Homo sapiens cDNA clone L8SCKO-8-H08 mRNA sequence UI-E-EJ1-ajp-n-20-0-UI.rl UI-E-EJ1 Homo sapiens cDNA clone UI-E- EJ1-ajp-n-20-0-UI 5, mRNA sequence Homo sapiens pirin (iron-binding nuclear protein) (PIR), mRNA BX098660 Soares placenta Nb2HP Homo sapiens cONA clone IMAGp998L03214; IMAGE:143762, mRNA sequence Homo sapiens v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) (MAF), mRNA Homo sapiens microtubuleassociated protein 2 (MAP2), transcript variant 4, mRNA 5.84 Down 5.84 Down 5.81 Down 5.8 Down 5.78 Down 5.77 Down 5.77 Down 5.77 Down 4.05E-03 5.32E-04 9.71 E-04 5.47E-03 1.71 E-04 6.OOE-04 2.24E-04 1 .34E-03 24/05/06,15735 speci p,.127 128- NM_003057 AW242323 NM_052890 NM_000593 NM_033132 AL832380 NM_183376 NM_018700 NM_000782 BC035805 Homo sapiens solute carrier family 22 (organic cation transporter), member 1 (SLC22A1), transcript variant 1, mRNA xm96f03.x1 NCI_CGAP_Kid11 Homo sapiens cDNA clone IMAGE:2692061 3 similar to contains Alu repetitive element;, mRNA sequence Homo sapiens peptidoglycan recognition protein 2 (PGLYRP2), mRNA Homo sapiens transporter 1, ATPbinding cassette, sub-family B (MDRITAP) (TAP1), mRNA Homo sapiens Zic family member 5 (odd-paired homolog, Drosophila) mRNA Homo sapiens mRNA; cDNA DKFZp451L157 (from clone DKFZp451L157) Homo sapiens arrestin domain containing 4 (ARRDC4), mRNA Homo sapiens tripartite motifcontaining 36 (TRIM36), mRNA Homo sapiens cytochrome P450, family 24, subfamily A, polypeptide 1 (CYP24A1), nuclear gene encoding mitochondrial protein, mRNA Homo sapiens caspase recruitment domain family, member 9, mRNA (cDNA clone IMAGE:5745585), partial cds 5.75 Down 5.74 Down 5.73 Down 5.72 Down 5.71 Down 5.71 Down 5.71 Down 5.7 Down 5.69 Down 5.68 Down 2.42E-04 1.92E-04 1.14E-04 4.86E-03 1.76E-04 1.54E-04 5.88E-04 1.32E-02 1.82E-02 4.00E-03 24/05/06,15735 speci gp, 128 129 BC051 727 NM_022842 NM_004335 Homo sapiens cDNA clone IMAGE:5265929, partial cds Homo sapiens CUB domaincontaining protein 1 (CDCP I), transcript variant 1, mRNA Homo sapiens bone marrow stromal cell antigen 2 (BST2), mRNA 5.68 Down 5.68 Down 5.67 Down 5.66 Down 5.13E-04 1 .85E-03 6.01 E-03 8.07E-03 NM_053039 Homo sapiens UDP glycosyltransferase 2 family, polypeptide B28 (UGT2B28), mRNA NM_004529 AK093069 NM_005141 NM_000682 BF51 2326 NM_003726 Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (MLLT3), mRNA Homo sapiens cDNA FLJ35750 fis, clone TEST12004539, weakly similar to Homo sapiens adlican mRNA Homo sapiens fibrinogen, B beta polypeptide (FGB), mRNA Homo sapiens adrenergic, alpha-2B- Sreceptor (ADRA2B), mRNA UI-H-BW1 -amb-g-1 2-0-Ulsi NCI_CGAP_Sub7 Homo sapiens cDNA clone IMAGE:3069503 3, mRNA sequence Homo sapiens src family associated phosphoprotein 1 (SCAPI), mRNA 5.66 Down 5.65 Down 5.63 Down 5.61 Down 5.6 Down 5.6 Down 5.6 Down 4.02E-04 1.10E-03 7.89E-04 1.14E-04 1 .49E-04 2.42E-03 4.42E-04 AK024261 Homo sapiens cDNA FLJ 14199 fis, clone NT2RP300271 3 AK125695 Homo sapiens cDNA FLJ43707 fis, clone TESOP2001 865 5.59 Down 1.10 E-02 24/05/06,15735 speci gp, 129 130- NM_006074 AW591461 NM_022128 Homo sapiens tripartite motifcontaining 22 (TRIM22), mRNA x192h06.xl NCICGAPUti Homo sapiens cDNA clone IMAGE:2682203 3, mRNA sequence Homo sapiens ribokinase (RBKS), mRNA 5.58 Down 5.58 Down 5.58 Down 5.57 Down 5.56 Down N66105 yy65eO6.sl Soaresmultiple-sclerosis2NbHMS P Homo sapiens cDNA clone IMAGE.278434 3, mRNA sequence BC0351 16 Homo sapiens cDNA clone IMAGE5263177, partial cds 1.94E-03 1 .95E-02 1.87E-04 2.84E-04 5.49E-04 2.48E-03 9.71 E-04 3.52E-03 7.43E-03 3.44E-03 BM988642 NM_003947 UI-H-DHO-arx-p-21 -0-UI .sl NCICGAPOHO Homo sapiens cDNA clone IMAGE:.5855492 3, mRNA sequence Homo sapiens huntingtin-associated protein interacting protein (duo) (HAPIP), mRNA 5.56 Down 5.56 Down 5.56 Down 5.55 Down 5.54 Down A1697906 wel8fO6.xl NCICGAPLu24 Homo sapiens cDNA clone IMAGE.2341475 3, mRNA sequence AK095399 Homo sapiens cDNA FLJ38080 fis, clone CTONG201 6185 ALl110252 Homo sapiens mRNA; cDNA DKFZp566A1 046 (from clone DKFZp566A1 046) NM_024572 Homo sapiens UDP-N-acetyl-alpha- D-galactosamine:polypeptide Nacetylgalactosaminyltransferase 14 (GaINAc-T14) (GALNT14), mRNA 5.54 Down 5.93E-03 24/05/06,15735 speci gp, 130 131 NM_000775 NM_018317 NM_030915 NM_1 39241 CB047092 Homo sapiens cytochrome P450, family 2, subfamily J, polypeptide 2 (CYP2J12), mRNA Homo sapiens hypothetical protein FLJ 11082 (FLJ 11082), mRNA Homo sapiens likely ortholog of mouse limb-bud and heart gene (LBH), mRNA Homo sapiens FYVE, RhoGEF and PH domain containing 4 (FGD4), mRNA NlSCgfO8fO3.xl NCI_CGAP_Kidl2 Homo sapiens cDNA clone IMAGE:3253013 3, mRNA sequence Homo sapiens EGF-like repeats and discoidin I-like domains 3 (EDIL3), mRNA onO2eO8.sl NCICGAPKid3 Homo sapiens cONA clone IMAGE: 1555526 3, mRNA sequence Homo sapiens coagulation factor XIII, Al polypeptide (F13A1), mRNA Homo sapiens phospholipase A2 receptor 1, l8OkDa (PLA2R1), transcript variant 1, mRNA Homo sapiens mRNA; cDNA DKFZp761 J1112 (from clone D KFZp761 J 1112) 5.53 Down 5.51 Down 5.51 Down 5.5 Down 5.5 Down 5.5 Down 1 .57E-03 5.10E-04 6.86E-04 9.42E-03 5.38E-04 6.04E-04 NM_005711 AA974 968 5.49 Down 1 .63E-03 NM_000129 NM_007366 AL353944 5.49 Down 5.47 Down 5.46 Down 5.46 Down 5.46 Down 1 .09E-02 4.66E-03 5.38E-04 1.61 E-03 3.33E-03 AK095647 Homo sapiens cDNA FLJ38328 fis, clone FCBBF3025142 BQ1 88860 UI-E-EJ1 -ajx-h-03-0-UI.rl UI-E-EJ1 Homo sapiens cDNA clone UI-E- 24/05/06,15735 speci gp, 131 132 EJ1-ajx-h-03-0-UI 5, mRNA sequence NM_017594 NM_014399 NM_033255 AW269270 Homo sapiens DIRAS family, GTPbind ing RAS-like 2 (DIRAS2), mRNA Homo sapiens transmembrane 4 superfamily member 13 (TM4SF1 3), mRNA Homo sapiens epithelial stromal interaction 1 (breast) (EPSTI1), mRNA xs3Scll.xl NCICGAPKidli Homo sapiens cDNA clone IMAGE:2771636 3 similar to contains L1.t3 Li repetitive element ;mRNA sequence 5.44 Down 5.43 Down 5.43 Down 5.42 Down 5.42 Down 1 .22E-02 2.64E-04 1 .73E-03 1 .33E-03 1.09E-04 AK092456 Homo sapiens cDNA FLJ35137 fis, clone PLACE600941 9 NM_031935 BU751 966 NM_001747 NM_002260 AA732841 Homo sapiens hemnicentin (FIBL-6), mRNA UI1-1 -BBO-acy-c-09-O-UI 1si NCICGAPP14 Homo sapiens cDNA clone UI-1-BBO-acy-c-09-0-UI 3, mRNA sequence Homo sapiens capping protein (actin filament), gelsolin-like (CAPG), mRNA Homo sapiens killer cell lectin-like receptor subfamily C, member 2 (KLRC2), mRNA zg77fOl .sl Soares-fetal-heartNbHH19W Homo sapiens cDNA clone 5.42 Down 5.4 Down 5.4 Down 5.4 Down 5.4 Down 7.69E-04 1.61 E-03 1.33E-03 1.2 1E-02 3.48E-03 24/05/06,15735 speci gp, 132 133 IMAGE.399385 3, mRNA sequence AK055468 Homo sapiens cONA FLJ30906 fis, clone FEBRA2006055 A10801 64 NM_005562 NM_080659 NM_015085 BX097034 NM_002147 NM_1 81785 NM_032857 BX113144 NM_014905 oz48c05.xl Soares_NhHMPu_Si Homo sapiens cDNA clone IMAGE:1678568 3, mRNA sequence Homo sapiens laminin, gamma 2 (LAMC2), transcript variant 1, mRNA Homo sapiens similar to RIKEN cDNA 2310030G06 gene (MGC14839), mRNA Homo sapiens GTPase activating Rap/RanGAP domain-like 4 (GARNL4), mRNA BX097034 Soares infant brain 1 NIB Homo sapiens cDNA clone IMAGp998F14169; IMAGE:39685, mRNA sequence Homo sapiens homeo box B5 mRNA Homo sapiens hypothetical protein L0C283537 (L0C283537), mRNA Homo sapiens lactamase, beta (LACTB), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA 8X1 13144 Soares placenta Nb2HP Homo sapiens cDNA clone IMAGp998N07225; IMAGE:148038, mRNA sequence Homo sapiens glutamninase (GILS), mRNA 5.4 Down 5.38 Down 5.38 Down 5.36 Down 5.36 Down 5.36 Down 5.35 Down 5.33 Down 5.33 Down 5.32 Down 5.31 Down 1 .36E-03 2.44E-03 3.78E-04 3.81 E-03 1.86E-04 8.59E-05 8.21 3.48E-04 2.45E-04 1 .53E-03 1 .63E-03 24/05/06,15735 speci gp.133 134- INO ct NM_138396 NM_004433 AA553553 AW188195 NM_006169 NM_000071 NM_001958 AK055356 NM_014578 NM_013230 Homo sapiens membraneassociated RING-CH protein IX (MARCH-IX), mRNA Homo sapiens E74-like factor 3 (ets domain transcription factor, epithelial-specific) (ELF3), mRNA nk78d11.s1 NCI_CGAP_Schl Homo sapiens cDNA clone IMAGE: 1019637 3, mRNA sequence xj93e12.x1 Soares_NFL_T_GBC_S1 Homo sapiens cDNA clone IMAGE:2664814 3 similar to contains element THR repetitive element;, mRNA sequence Homo sapiens nicotinamide Nmethyltransferase (NNMT), mRNA Homo sapiens cystathionine-betasynthase (CBS), mRNA Homo sapiens eukaryotic translation elongation factor 1 alpha 2 (EEF1A2), mRNA Homo sapiens cDNA FLJ30794 fis, clone FEBRA2001093, weakly similar to MONOCARBOXYLATE TRANSPORTER 4 Homo sapiens ras homolog gene family, member D (RHOD), mRNA Homo sapiens CD24 antigen (small cell lung carcinoma cluster 4 antigen) (CD24), mRNA 5.31 Down 5.3 Down 5.27 Down 5.27 Down 5.26 Down 5.26 Down 5.25 Down 5.25 Down 5.24 Down 5.22 Down 5.2 Down 1.39E-04 5.32E-05 1.69E-03 5.32E-05 7.45E-05 1.49E-03 5.20E-03 8.65E-04 5.43E-03 7.65E-04 6.04E-03 AF086158 Homo sapiens full length insert 24/05/06,15735 speci gp,134 135- INO Ct cDNA clone ZB72E12 NM_004932 NM_020466 Homo sapiens cad herin 6, type 2, Kcadherin (fetal kidney) (CDH6), mRNA Homo sapiens hypothetical protein d,112208.2 (DJ 12208.2), mRNA AL1 17425 Homo sapiens mRNA; cDNA DKFZp566L2O3 (from clone DKFZp566L2O3) A1732568 zo23d12.x5 Stratagene colon (#937204) Homo sapiens cDNA clone IMAGE:587735 3, mRNA sequence A1150192 qf34d12.xl Soares-testisNHT Homo sapiens cDNA clone IMAGE:1751927 3, mRNA sequence AK125852 Homo sapiens cDNA FLJ43864 fis, clone TEST14007799 5.18 Down 5.18 Down 5.17 Down 5.17 Down 5.17 Down 5.17 Down 5.15 Down 5.14 Down 5.14 Down 5.12 Down 5.11 Down 5.11 Down 2.11 E-04 2.99E-03 NM_017912 NM_006174 Homo sapiens hect domain and RLD 6 (HERC6), mRNA Homo sapiens neuropeptide Y receptor Y5 (NPY5R), mRNA 8.64E-03 9.19E-04 1.21 E-02 4.82E-03 3.63E-04 1. 13E-02 9.71 E-04 1 .27E-04 3.48E-04 2.05 E-03 AK025281 Homo sapiens cDNA: FLJ2 1628 fis, clone COL08076 NM_153742 NM_003107 Homo sapiens cystathionase (cystathionine gamma-lyase) (CTH), transcript variant 2, mRNA Homo sapiens SIRY (sex determining region Y)-box 4 (SOX4), mRNA NM_003948 Homo sapiens cyclin-dependent M405/06,15735 speci gp, 13 136kinase-like 2 (CDC2-related kinase) (CDKL2), mRNA Homo sapiens hypothetical protein FLJ33718 (FLJ33718), mRNA NM_173660 5.11 Down 5.1 Down 1.30 E-03 6.19E-03 A1693580 wdl2dOl.xl NClCGAPCo3 Homo sapiens cDNA clone IMAGE:2327905 3, mRNA sequence NM_004482 NM_030965 NM_016147 NM_006259 NM_002993 BE671 338 BX647256 Homo sapiens UDP-N-acetyl-alpha- D-galactosamine:polypeptide Nacetylgalactosaminyltransferase 3 (GalNAc-T3) (GALNT3), mRNA Homo sapiens sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-betagalactosyl-1 ,3)-N-acetyl galactosaminide alpha-2,6sialyltransferase) E (SIAT7E), mRNA Homo sapiens protein phosphatase methylesterase-1 (PME-1), mRNA Homo sapiens protein kinase, cGMP-dependent, type 11 (PRKG2), mRNA Homo sapiens chemokine (C-X-C motif) ligand 6 (granulocyte chemnotactic protein 2) (CXCL6), mRNA 7e49f03.xl NCICGAPLu24 Homo sapiens cDNA clone IMAGE:3285821 3, mRNA sequence Homo sapiens mRNA; cDNA DKFZp686K0753 (from clone DKFZp686K0753) 5.1 Down 5.1 Down 5.09 Down 5.08 Down 5.07 Down 5.07 Down 5.07 Down 2.31 E-03 2.61 E-04 9.71 E-04 1.36E-03 2.32E-03 1 .28E-02 2.05E-02 24/05/06,15735 speci gp. 136 137- BG186566 RST5534 Athersys RAGE Library Homo sapiens cDNA, mRNA sequence AV652758 AV652758 GLC Homo sapiens cDNA clone GLCDDG05 3, mRNA sequence A1672441 waO3cO3.xl NCICGAPKidi 1 Homo sapiens cDNA clone IMAGE:2296996 3, mRNA sequence AA769642 ob20h04.sl NClCGAPKid5 Homo sapiens cDNA clone IMAGE: 1324279 3, mRNA sequence AL706653 DKFZp686E1 543_r1 686 (synonym: hlcc3) Homo sapiens cDNA clone DKFZp686E1543 5, mRNA sequence AW296834 Ul-H-B12-ahz-a-1 0-0-UI si NCICGAPSub4 Homo sapiens cDNA clone IMAGE:2728243 3, mRNA sequence 5.05 Down 5.04 Down 8.91 E-04 1.05 E-03 5.04 Down 5.02 Down 5.02 Down 5.01 Down 1. 11 E-02 1 .59E-02 1.09E-03 5.93E-03 TABLE VII B: GENES THAT WERIE DIFFERENTIALLY EXPRESSED AT LEAST 5 FOLD IN EPITHELIAL VERSUS FIBROBLAST CELLS Gene Identifier Gene Name Average Direction adj. pfold value change in Epithelial versus fibroblast 24/05f06,15735 speci gp, 137 138cells NM_018658 NM_014358 Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 16 (KCNJ16), transcript variant 1, mRNA Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 9 (CLECSF9), mRNA 481.28 UP 375.12 UP 331.92 UP 316.78 UP 2.64E-05 6.56E-05 1.60E-05 8.39E-06 AB032980 Homo sapiens mRNA for KIAA1154 protein, partial cds BG219729 RST39494 Athersys RAGE Library Homo sapiens cDNA, mRNA sequence NM_002899 NM_007038 NM_002423 NM_001977 D29453 NM_024508 Homo sapiens retinol binding protein 1, cellular (RBP1), mRNA Homo sapiens a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase- 2) (ADAMTS5), mRNA Homo sapiens matrix metalloproteinase 7 (matrilysin, uterine) (MMP7), mRNA Homo sapiens glutamyl aminopeptidase (aminopeptidase A) (ENPEP), mRNA HUMNK566 Human epidermal keratinocyte Homo sapiens cDNA clone 566, mRNA sequence Homo sapiens zinc finger, BED domain containing 2 (ZBED2), mRNA 314.6 UP 280.99 UP 269.82 UP 242.27 UP 208.36 UP 168.99 UP 165.99 UP 145.52 UP 5.37E-05 1.26E-05 8.65E-06 5.43E-05 1.72E-05 8.39E-06 A1335277 tb29h06.x1 NCI_CGAP_Kidl2 Homo sapiens cDNA clone IMAGE:2055803 3, mRNA sequence BE877764 601486331F1 NIH_MGC_69 Homo sapiens cDNA clone IMAGE:3888943 5, mRNA 8.46E-06 2.36E-05 24/05/06,15735 speci gp. 13 8 139sequence A1765021 wh56c02.xl NOICGAPKidi 1 Homo sapiens cIDNA cione IMAGE:2384738 3, mRNA sequence 145.09 UP 1. 15E-05 NM_024726 NM_004221 NM_019000 NM_000104 Homo sapiens IQ motif containing with AAA domain (IQCA), mRNA Homo sapiens natural killer cell transcript 4 (NK4), mRNA Homo sapiens hypothetical protein FLJ20152 (FLJ20152), mRNA Homo sapiens cytochrome P450, family 1, subfamily B, polypeptide 1 (CYPi13i), mRNA 143.09 UP 142.15 UP 131.23 UP 127.7 UP 127.35 UP 8.39E-06 1 .88E-05 1 .88E-05 1. 51 4.13E-05 BM9931 16 UI-H-DTO-aty-f-1 7-0-UI si NCIOGAPDTO Homo sapiens clDNA clone IMAGE:5866000 3, mRNA sequence NM_031426 NM_152369 NM_00381 0 NM_023942 NM_005560 NM_001453 Homo sapiens chromosome 9 open reading frame 58 (C9orf58), transcript variant 1, mRNA Homo sapiens hypothetical protein MGC45474 (MGC45474), mRNA Homo sapiens tumor necrosis factor (ligand) superfamily, member 10 (TNFSF1O), mRNA Homo sapiens hypothetical protein MGC3036 (MGC3036), mRNA Homo sapiens laminin, alpha 5 (LAMA5), mRNA Homo sapiens forkhead box C1 (FOXCi), mRNA 116.09 UP 112.28 UP 112.19 UP 111.27 UP 110.51 UP 107.21 UP 103.23 UP 3.82E-05 2.18E-05 2.96E-05 1. 15E-05 1.37E-05 1.15E-05 2.89E-05 BU7342 12 UI-E-CQ1 -agd-e-2 1-0-UI si UI-E-CQ 1 Homo sapiens cIDNA clone UI-E-CQ1 -agd-e-2 1 -0-UI 3, mRNA sequence 24/05/06,15735 speci gp, 139 -140- AK026966 Homo sapiens cDNA: FLJ23313 fis, clone H EP 11919 CA425961 UI-.H-FE-beg-p-18-0-UI.sl NCI_CGAP_FEI Homo sapiens cDNA clone UI-H-FE1 -beg-p-1 8- 0-UI 3, mRNA sequence AK075003 Homo sapiens cDNA FLJ90522 fis, clone NT2RP40001O8, highly similar to Human gene for neurofilament subunit NF-L 103.17 UP 102.53 UP 101.8 UP 1.78E-05 6.21 2.31 E-04 NM_018265 Homo sapiens hypothetical protein FLJ 10901 (FLJ1O9O1), mRNA 99.41 UP 98.88 UP 3.66E-05 9.08 E-06 AK058012 Homo sapiens cDNA FLJ25283 fis, clone STM06716 NM_004098 Homo sapiens empty spiracles homolog 2 (Drosophila) (EMX2), mRNA AK096481 Homo sapiens cDNA FLJ39 162 fis, clone OCBBF2002376 97.96 UP 94.93 UP 91.63 UP 85.24 UP 4.13E-05 2.83 2.31 1.78E-05 NM_003238 Homo sapiens transforming growth factor, beta 2 (TGFB2), mRNA A1244954 aj93h05.xl NCI_CGAP_Kid3 Homo sapiens cDNA clone IMAGE: 1867065 3, mRNA sequence NM_173505 Homo sapiens ankyrin repeat domain 29 (ANKRD29), mRNA AKII 30281 Homo sapiens cDNA FLJ26771 fis, clone PRS031 89 NM_153026 Homo sapiens prickle-like 1 (Drosophila) (PRICKLEl), mRNA 82.89 UP 82.02 UP 81.73 UP 79.69 UP 79.31 U P 3.53E-05 3.66E-06 1 .78E-05 1 .70E-05 8.41 AK092401 Homo sapiens clDNA FLJ35082 fis, clone PLACE6005351 ABO1 1539 Homo sapiens mRNA for MEGF6 protein 24/05/06,15735 speci gp. 140 141 (KIAAO815), partial cds NM_016356 Homo sapiens doublecortin domain containing 78.04 UP 6.98E-05 2 (DCDC2), mRNA AK023631 Homo sapiens cDNA FLJ 13569 fis, clone 77.68 UP 2.09E-05 PLACE 1008369 NM_024422 Homo sapiens desmocollin 2 (DSC2), transcript 73.14 UP 7.38E-05 variant Dsc2a, mRNA BX648964 Homo sapiens mRNA; cDNA DKFZp686J0156 70.68 UP 6.92E-05 (from clone DKFZp686JO1 56) T56535 yb33g07.rl Stratagene fetal spleen (#937205) 69.74 UP 2.03E-05 Homo sapiens cONA clone IMAGE:73020 mRNA sequence BG197054 RST16291 Athersys RAGE Library Homo 69.48 UP 4.96E-05 sapiens clDNA, mRNA sequence NM_005949 Homo sapiens metallothionein 1iF (functional) 68.1 UP 2.03E-05 (MT1 mRNA AK090808 Homo sapiens cDNA FLJ33489 fis, clone 65.29 UP 2.87E-05 BRAMY2003585 CA306881 UI-H-FT1-bht-n-22-O-UI.sl NCICGAPFT1 64.98 UP 2.93E-05 Homo sapiens cDNA clone UI-H-FT1-bht-n-22- 0-Ul 3, mRNA sequence NM_001448 Homo sapiens glypican 4 (GPC4), mRNA 64.85 UP 2.45E-04 AL833276 Homo sapiens mRNA; cDNA DKFZp451 D088 64.7 UP 1.98E-05 (from clone DKFZp451 D088) BC044843 Homo sapiens hypothetical protein 63.8 UP 7.59E-05 L0C339535, mRNA (cONA clone IMAGE:5186761), partial cds BF798098 RC1-C10045-021000-021-f02 C10045 Homo 58.58 UP 3.04E-05 sapiens clDNA, mRNA sequence H89526 yw28b04.rl Morton Fetal Cochlea Homo 56.92 UP 3.82E-05 24/05/06,15735 speci gp. 141 142sapiens cIDNA clone IMAGE:253519 5, mRNA sequence BF509573 UI-H-B314-apf-b-11-0-UI.sl NCI_CGAP_Sub8 Homo sapiens cIDNA clone IMAGE:3086949 3, mRNA sequence 56.79 UP 2.83E-05 NM_000990 Homo sapiens ribosomal protein L27a (RPL27A), mRNA BC042028 Homo sapiens, clone IMAGE:4794726, mRNA NM_003287 NM_018168 NM_152284 Homo sapiens tumor protein 052-like 1 (TPD52L1), transcript variant 1, mRNA Homo sapiens chromosome 14 open reading frame 105 (Cl4orflO5), mRNA Homo sapiens Snf7 homologue associated with Alix 3 (Shax3), mRNA 56.36 UP 55.75 UP 55.25 UP 54.64 UP 54.16 UP 54.14 UP 53.24 UP 1.73E-05 1 .64E-05 8.46E-06 4.79E-05 9.09E-06 8.37E-05 7.14E-05 AK096975 Homo sapiens cIDNA FLJ39656 fis, clone SMI NT2005956 A1249696 qj64a03.xl NCICGAPKid3 Homo sapiens cDNA clone IMAGE:1864204 3, mRNA sequence NM_003551 Homo sapiens non-metastatic cells 5, protein expressed in (n ucleoside-d iphosphate kinase) mRNA BX1 18238 BX1 18238 NCI_CGAP_Kid3 Homo sapiens cIDNA clone IMAGp998L1 53800; IMAGE: 1501 598, mRNA sequence BX102632 BX102632 NCI_CGAP_Co3 Homo sapiens cIDNA clone IMAGp998J052307; IMAGE:928228, mRNA sequence AF055376 Homo sapiens short form transcription factor C- MAE (c-maf) mRNA, complete cds 53.01 UP 51.99 UP 51.79 UP 51.22 UP 4.75E-05 5.64E-05 9. 1OE-05 3.94E-05 NM_012464 Homo sapiens tolloid-like 1 (TLL1), mRNA 51.19 UP 6.57E-04 24/05/06,15735 speci gp. 142 143- NM_030949 Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 14C (PPP1R14C), mRNA 49.96 UP 49.05 UP 5.80E-05 1.78E-05 BM669002 UI-E-CK1-afn-m-04-0-Ul.s2 UI-E-CK1 Homo sapiens cDNA clone UI-E-CK1-afn-m-04-0-UI 3, mRNA sequence O NM_000582 NM_006722 NM_152423 Homo sapiens secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early Tlymphocyte activation 1) (SPP1), mRNA Homo sapiens microphthalmia-associated transcription factor (MITF), transcript variant 3, mRNA Homo sapiens melanoma associated antigen (mutated) 1-like 1 (MUM1L1), mRNA 46.79 UP 46.73 UP 46.24 UP 45.76 UP 6.18E-05 1.26E-05 1.48E-04 4.39E-05 AA075748 zm89e04.rl Stratagene ovarian cancer (#937219) Homo sapiens cDNA clone IMAGE:545118 5, mRNA sequence NM_017549 Homo sapiens upregulated in colorectal cancer gene 1 (UCC1), mRNA 45.18 UP 44.98 UP 1.24E-05 7.75E-05 BF431030 7o18c06.x1 NCI_CGAP_Kid11 Homo sapiens cDNA clone IMAGE:3574283 3, mRNA sequence NM_002245 NM_003494 Homo sapiens potassium channel, subfamily K, member 1 (KCNK1), mRNA Homo sapiens dysferlin, limb girdle muscular dystrophy 2B (autosomal recessive) (DYSF), mRNA 44.3 UP 44.23 UP 43.88 UP 42.34 UP 4.65E-05 1.78E-05 7.31E-05 2.96E-05 AK074097 Homo sapiens mRNA for FLJ00168 protein NM_013410 Homo sapiens adenylate kinase 3 (AK3), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA 24/05/06,15735 speci gp,143 144- AK000075 Homo sapiens cODNA FLJ20068 fis, clone COL01 755 42.18 UP 1 .35E-04 NM_001200 NM_032782 AW1 51660 Homo sapiens bone morphogenetic protein 2 (BMP2), mRNA Homo sapiens hepatitis A virus cellular receptor 2 (HAVCR2), mRNA xf67d04.xl NCICGAPGas4 Homo sapiens cIDNA clone IMAGE:26231 11 3, mRNA 41.13 UP 41.13 UP 40.6 UP 2.I11E-05 2.83E-05 8.65E-05 sequence NM_130435 Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript variant 2, mRNA 40.41 UP 1 .62E-04 AA738254 nx1 3b02.sl NCIOGAPGC3 Homo sapiens cIDNA clone IMAGE: 1255947 3, mRNA sequence AK1 24873 Homo sapiens cONA FLJ42883 fis, clone BRHIP3006683 40.24 UP 40.2 UP 2.43E-05 1 .25E-04 NM_000170 Homo sapiens glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P) (GLODC), mRNA AK1 25490 Homo sapiens cODNA FLJ43501 fis, clone PEBLM2004497 NM_004862 NM_004617 NM_001263 Homo sapiens lipopolysaccharide-induced TNF factor (LITAF), mRNA Homo sapiens transmembrane 4 superfamily member 4 (TM4SF4), mRNA Homo sapiens COP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1 (COSi), mRNA 40.06 UP 39.93 UP 39.52 UP 39.3 UP 39.26 UP 38.12 UP 4.98E-05 1.64E-04 1.37E-05 9. 32E-05 3.44E-05 2.83 AK000776 Homo sapiens cODNA FLJ20769 fis, clone 24/05/06,15735 speci gp, 144 145 C0L06674 AL833166 Homo sapiens mRNA; cDNA DKFZp68612118 37.72 UP 1. 14E-04 (from clone DKFZp68612118) NM_198488 Homo sapiens FLJ46072 protein (FLJ46072), 37.66 UP 2.46E-05 mRNA NM_005562 Homo sapiens laminin, gamma 2 (LAMC2), 37.4 UP 8.46E-06 transcript variant 1, mRNA AW268540 xv~lelO.xl NCICGAPLu28 Homo sapiens 37.26 UP 5.82E-05 cDNA clone IMAGE:2816682 3, mRNA sequence NM_012198 Homo sapiens grancalcin, EF-hand calcium 36.52 UP 2.13E-05 binding protein (GCA), mRNA NM_020808 Homo sapiens signal-induced proliferation- 36.28 UP 9.39E-05 associated 1 like 2 (SIPA1IL2), mRNA NM_000927 Homo sapiens ATP-binding cassette, sub- 35.89 UP 2.20E-04 family B (MDRFVAP), member 1 (ABCB1), mRNA AK127644 Homo sapiens cONA FLJ45742 fis, clone 35.81 UP 3.60E-04 KIDNE2016327 NM_006158 Homo sapiens neurofilament, light polypeptide 35.78 UP 2.64E-05 68kDa (NEEL), mRNA AK074181 Homo sapiens mRNA for FLJ00254 protein 35.75 UP 8.46E-06 BC043195 Homo sapiens cDNA clone IMAGE:5288757, 35.12 UP 1.24E-04 partial cds AL389942 Homo sapiens mRNA full length insert cDNA 34.31 U P 1 .37E-04 clone EUROIMAGE 2005635 BC045828 Homo sapiens zinc finger protein 608, mRNA 34.02 UP 1 .88E-05 (cDNA clone IMAGE:5262896), partial cds NM_153229 Homo sapiens hypothetical protein FLJ33318 34.02 UP 9.39E-05 (FLJ33318), mRNA 24/05/06,15735 speci gp, 1 4 -146- NM_184087 NM_000216 Homo sapiens tripartite motif-containing 55 transcript variant 4, mRNA Homo sapiens Kallmann syndrome 1 sequence (KAL1), mRNA 33.68 UP 33.32 UP 32.7 UP 2.18E-05 1.78E-05 5.00E-05 BF696790 602125323F1 NIH_MGC_56 Homo sapiens cDNA clone IMAGE:4282540 5, mRNA sequence NM 006598 Homo sapiens solute carrier family 12 32.41 UP 8.39E-06 (potassium/chloride transporters), member 7 (SLC12A7), mRNA BQ003401 UI-H-EI1-azd-j-23-0-UI.s1 NCI_CGAP_EI1 Homo sapiens cDNA clone IMAGE:5847286 3, mRNA sequence 32.41 UP 1.72E-05 NM_003222 NM_000599 NM_198389 NM_180991 NM_031311 NM_052947 H89053 Homo sapiens transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) (TFAP2C), mRNA Homo sapiens insulin-like growth factor binding protein 5 (IGFBP5), mRNA Homo sapiens lung type-I cell membraneassociated glycoprotein (T1A-2), transcript variant 2, mRNA Homo sapiens solute carrier organic anion transporter family, member 4C1 (SLCO4C1), mRNA Homo sapiens carboxypeptidase, vitellogeniclike (CPVL), transcript variant 1, mRNA Homo sapiens heart alpha-kinase (HAK), mRNA yw24c06.rl Morton Fetal Cochlea Homo sapiens cDNA clone IMAGE:253162 5, mRNA sequence 32.33 UP 32.1 UP 31.44 UP 30.86 UP 29.97 UP 29.53 UP 29.27 UP 4.75E-05 5.66E-05 1.03E-04 3.05E-04 4.30E-05 4.34E-05 2.78E-05 24/05/06.15735 speci gp, 146 147- A1819186 wj32d10.xl NCICGAPKidl2 Homo sapiens cONA clone IMAGE:2404531 3, mRNA sequence 29.14 UP 1. 21 E-04 NM_003761 NM_080743 NM_007069 NM_002345 Homo sapiens vesicle-associated membrane protein 8 (endobrevin) (VAMP8), mRNA Homo sapiens serine-arginine repressor protein kDa) (SRrp35), mRNA Homo sapiens HRAS-Iike suppressor 3 (HRASLS3), mRNA Homo sapiens lumican (LUM), mRNA 28.5 UP 27.83 UP 27.51 UP 27.17 UP 27.05 UP 7.47E-05 1.02E-05 6.86E-06 2.20E-05 3.20E-05 BU569937 AGENCOURT_10399817 NIHMGC_82 Homo sapiens cDNA clone IMAGE:661801 1 5, mRNA sequence NM_024901 N25875 Homo sapiens hypothetical protein FLJ22457 (FLJ22457), mRNA yw78d12.sl Soares placenta_Bto9weeks_2 NbH P8to9W Homo sapiens cDNA clone IMAGE:258359 3, mRNA sequence Homo sapiens RAS and EF hand domain containing (RASEF), mRNA Homo sapiens myosin VC (MYO5C), mRNA 27.04 UP 26.94 UP 5.37E-05 3.36E-05 NM_1 52573 NM_018728 AB033048 Homo sapiens mRNA for KIAA1 222 protein, partial cds 26.91 UP 26.81 UP 26.76 UP 26.61 UP 26.25 UP 26.16 UP 4.75E-05 4.47E-05 1 .90E-04 2.48E-05 2.06E-04 6.51 NM_153256 Homo sapiens chromosome 10 open reading frame 47 (Cl Oorf47), mRNA BG221364 RST41175 Athersys RAGE Library Homo sapiens cONA, mRNA sequence NM_000094 Homo sapiens collagen, type VII, alpha 1 (epidermolysis bullosa, dystrophic, dominant 24/05/06,15735 speci gp, 147 148and recessive) (COL7A1), mRNA Homo sapiens collagen, type XI, alpha 1 (COL11A1), transcript variant A, mRNA NM_001854 25.88 UP 25.64 UP 1.36E-04 5.14E-05 BU740051 UI-E-EO0-ahw-n-18-0-Ul.sl UI-E-EOO Homo sapiens cDNA clone UI-E-EOO-ahw-n-18-0-UI 3, mRNA sequence NM_014936 NM_024898 W93585 Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative function) (ENPP4), mRNA Homo sapiens family with sequence similarity 31, member C (FAM31C), mRNA zd95g01.sl Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone IMAGE:357264 3, mRNA sequence 25.62 UP 25.44 UP 25.41 UP 25.28 UP 2.82E-04 7.17E-04 1.78E-05 2.11E-05 BF510493 UI-H-B14-apa-b-08-0-Ul.sl NCI_CGAP_Sub8 Homo sapiens cDNA clone IMAGE:3086558 3, mRNA sequence NM_020962 NM_016212 NM_021012 NM_001935 NM_001993 NM_184087 Homo sapiens likely ortholog of mouse neighbor of Punc E11 (NOPE), mRNA Homo sapiens TP53TG3 protein (TP53TG3), mRNA Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 12 (KCNJ12), mRNA Homo sapiens dipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2) (DPP4), mRNA Homo sapiens coagulation factor III (thromboplastin, tissue factor) mRNA Homo sapiens tripartite motif-containing 55 transcript variant 4, mRNA 25.23 UP 25.14 UP 24.7 UP 24.67 UP 24.47 UP 24.38 UP 7.99E-05 4.07E-05 2 10E-04 8.46E-06 6.12E-05 8.46E-06 24/05/06,15735 speci gp, 148 149- AK056431 Homo sapiens cDNA FLJ31869 fis, clone NT2RP70021 51 24.34 UP 2.73E-05 NM_000775 NM_006722 Homo sapiens cytochrome P450, family 2, subfamily J, polypeptide 2 (CYP2J2), mRNA Homo sapiens microphthalmia-associated transcription factor (MITF), transcript variant 3, mRNA Homo sapiens glutamyl aminopeptidase (aminopeptidase A) (EN PEP), mRNA 24.04 UP 23.95 UP 3.53E-05 5.23E-06 NM_001977 AK058012 Homo sapiens cDNA FLJ25283 fis, clone STMO671 6 BU680661 UI-CF-DU1-aaz-f-04-0-UI.sl UI-CF-DU1 Homo sapiens cONA clone UI-CF-DU1-aaz-f-04-0-UI 3, mRNA sequence 23.91 UP 23.55 UP 23.17 UP 1 .88E-05 1 .88E-05 1.82E-05 NM_002246 NM_052923 NM_014373 Homo sapiens potassium channel, subfamily K, member 3 (KCNK3), mRNA Homo sapiens zinc finger protein 452 (ZNF452), mRNA Homo sapiens G protein-coupled receptor 160 (GPR16O), mRNA BX538226 Homo sapiens mRNA; cDNA DKFZp686E1944 (from clone DKFZp686E1944) 22.96 UP 22.72 UP 22.71 UP 22.58 UP 22.46 UP 21.97 UP 21.78 UP 21.76 UP 2.27E-05 3.77E-05 3.94E-05 1.05E-04 2.83E-05 2.83 2.21 E-04 4.41 E-04 NM_173660 NM_002354 NM_005822 W20132 Homo sapiens hypothetical protein FLJ33718 (FLJ33718), mRNA Homo sapiens tumor-associated calcium signal transducer 1 (TACSTD1), mRNA Homo sapiens Down syndrome critical region gene 1-like 1 (OSCRiLl), mRNA zb4OclO.rl Soares parathyroid tumorNbHPA Homo sapiens cDNA clone IMAGE:306066 24/05/06,15735 speci gp, 149 150 mRNA sequence NM_001680 NM_006379 H23441 Homo sapiens FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant a, mRNA Homo sapiens sema domain, immunoglobulin domain short basic domain, secreted, (semaphorin) 3C (SEMA3C), mRNA ym52fll.sl Soares infant brain IINIB Homo sapiens cDNA clone IMAGE:51888 3, mRNA sequence BG21 1832 RST31404 Athersys RAGE Library Homo sapiens cDNA, mRNA sequence N51335 NM_022843 NM_002521 NM_021 101 NM_004165 NM_005329 NM_1 38432 NM_004591 NM_003063 yzl5eOB.sl Soares multiple_sclerosis_2NbHMSP Homo sapiens cONA clone IMAGE:283142 3, mRNA sequence Homo sapiens protocadherin 20 (PCDH2O), mRNA Homo sapiens natriuretic peptide precursor B (NPPB), mRNA Homo sapiens claudin 1 (CLDN mRNA Homo sapiens Ras-related associated with diabetes (RRAD), mRNA Homo sapiens hyaluronan synthase 3 (HAS3), transcript variant 1, mRNA Homo sapiens serine dehydratase-like (SDSL), mRNA Homo sapiens chemokine (C-C motif) ligand 20 (CCL2O), mRNA Homo sapiens sarcolipin (SLN), mRNA 21.75 UP 21.57 UP 21.43 UP 21.35 UP 21.19 UP 21.17 UP 21.01 UP 20.92 UP 20.76 UP 20.73 UP 20.41 UP 20.34 UP 20.26 UP 3.26E-05 3.15E-05 3.51 5.06E-05 6.92E-03 2.03E-05 4.54E-04 3.04E-05 6.04E-04 4.13E-05 7.27E-05 3.29E-04 1. 18E-04 24/05/06,15735 speci gp.I150 151 BU951469 in60a05.x3 HR85 islet Homo sapiens cDNA clone IMAGE:6126249 3, mRNA sequence AI436290 th81c01.x1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:2125056 3, mRNA sequence 20.02 UP 19.92 UP 4.52E-04 9.28E-05 NM_014452 Homo sapiens tumor necrosis factor receptor superfamily, member 21 (TNFRSF21), mRNA 19.39 UP 19.2 UP 2.96E-05 1.78E-05 AA099748 z178c09.s1 Stratagene colon (#937204) Homo sapiens cDNA clone IMAGE:510736 3, mRNA sequence NM_018354 NM_194298 NM_033554 NM 004524 NM_032293 NM_022842 NM_000227 NM_000214 Homo sapiens chromosome 20 open reading frame 46 (C20orf46), mRNA Homo sapiens solute carrier family 16 (monocarboxylic acid transporters), member 9 (SLC16A9), mRNA Homo sapiens major histocompatibility complex, class II, DP alpha 1 (HLA-DPA1), mRNA Homo sapiens lethal giant larvae homolog 2 (Drosophila) (LLGL2), mRNA Homo sapiens GTPase activating Rap/RanGAP domain-like 3 (GARNL3), mRNA Homo sapiens CUB domain-containing protein 1 (CDCP1), transcript variant 1, mRNA Homo sapiens laminin, alpha 3 (LAMA3), transcript variant 2, mRNA Homo sapiens jagged 1 (Alagille syndrome) (JAG1), mRNA 18.87 UP 18.87 UP 18.6 UP 18.45 UP 18.19 UP 18.14 UP 18.04 UP 18.03 UP 17.89 UP 5.05E-04 9.82E-03 5.61 E-04 2.11E-05 2.24E-04 1.64E-05 3.92E-05 1.26E-04 3.05E-04 AK096580 Homo sapiens cDNA FLJ39261 fis, clone OCBBF2009391 24/05/06,15735 speci gp,151 152- NM_014243 NM_000856 NM_018404 NM_001 165 NM_003706 Homo sapiens a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3 (ADAMTS3), mRNA Homo sapiens guanylate cyclase 1, soluble, alpha 3 (GUCY1A3), mRNA Homo sapiens centaurin, alpha 2 (CENTA2), mRNA Homo sapiens baculoviral lAP repeatcontaining 3 (BIRC3), transcript variant 1, mRNA Homo sapiens phospholipase A2, group IVO (cytosolic, calcium-independent) (PLA2G4C), mRNA 17.86 UP 1.78E-05 17.85 UP 17.8 UP 17.74 UP 17.65 UP 17.65 UP 17.43 UP 17.4 UP 17.29 UP 1. 19E-04 3.05E-04 2.56 E-04 4.77E-05 4.33E-04 1 .04E-04 1.l1 7.13E-05 AK056882 Homo sapiens cDNA FLJ32320 fis, clone PROST2003537 NM_017640 NM_000480 Homo sapiens leucine rich repeat containing 16 (LRRC16), mRNA Homo sapiens adenosine monophosphate deaminase (isoform E) (AMPD3), mRNA BX103476 BX103476 NCICGAPLu5 Homo sapiens cONA clone IMAGp998C053946; IMAGE:1557436, mRNA sequence NM_013427 S70348 NM_032024 Homo sapiens Rho GTPase activating protein 6 (ARHGAP6), transcript variant 1, mRNA Homo sapiens integrin beta 3 mRNA, partial cds, alternatively spliced Homo sapiens chromosome 10 open reading frame 11 (Cl1Oorfi11), mRNA 17.27 UP 17.24 UP 16.95 UP 1 .48E-04 3.37E-05 3.03E-05 BM988642 Ul-H-DHO-arx-p-21-0-Ul.sl NCICGAPOHO Homo sapiens cDNA clone IMAGE:5855492 3, 16.94 UP 1 .94E-04 24/05/06,15735 speci gp, 152 153mRNA sequence NM_021102 Homo sapiens serine protease inhibitor, Kunitz type, 2 (SPINT2), mRNA 16.94 UP 16.88 UP 1.85E-04 7.19E-04 A1632692 wa33b05.x1 NCI_CGAP_Kid11 Homo sapiens cDNA clone IMAGE:2299857 3, mRNA sequence NM_152487 NM_173567 Homo sapiens hypothetical protein FLJ31842 (FLJ31842), mRNA Homo sapiens abhydrolase domain containing 7 (ABHD7), mRNA 16.75 UP 16.66 UP 16.59 UP 2.55E-04 2.13E-05 2.35E-04 CA502927 UI-CF-FNO-afq-j-12-0-UI.s1 UI-CF-FNO Homo sapiens cDNA clone UI-CF-FNO-afq-j-12-0-UI 3, mRNA sequence NM_015888 NM 178177 NM_005181 NM_000599 NM_006393 NM_006252 NM_002338 NM 006378 Homo sapiens hook homolog 1 (Drosophila) (HOOK1), mRNA Homo sapiens nicotinamide nucleotide adenylyltransferase 3 (NMNAT3), mRNA Homo sapiens carbonic anhydrase III, muscle specific (CA3), mRNA Homo sapiens insulin-like growth factor binding protein 5 (IGFBP5), mRNA Homo sapiens nebulette (NEBL), transcript variant 1, mRNA Homo sapiens protein kinase, AMP-activated, alpha 2 catalytic subunit (PRKAA2), mRNA Homo sapiens limbic system-associated membrane protein (LSAMP), mRNA Homo sapiens sema domain, immunoglobulin domain transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D (SEMA4D), mRNA 16.44 UP 16.43 UP 16.42 UP 16.27 UP 16.13 UP 16.12 UP 16.11 UP 16.09 UP 4.12E-05 1.56E-04 4.93E-05 4.97E-04 6.06E-04 5.64E-04 2.81 E-04 1.78E-05 24/05/06,15735 speci gp,153 154- IND Ct A1819863 wj45h05.xl NCICGAPLul 9 Homo sapiens cODNA clone IMAGE:2405817 3, mRNA sequence BM979825 UI-CF-DU1-adt-f-12-0-Ul.sl UI-OF-DUl Homo sapiens cODNA clone UI-CF-DUl1-adt-f-1 3, mRNA sequence BX647876 Homo sapiens mRNA; clDNA DKFZp31 3A1 525 (from clone DKFZp313A1 525) NM_003730 Homo sapiens ribonuclease T2 (RNASET2), mRNA ALl 17425 Homo sapiens mRNA; cODNA DKFZp566L2O3 (from clone DKFZp566L2O3) AL833346 Homo sapiens mRNA; clDNA DKFZp686M2234 (from clone DKFZp686M2234) 15.95 UP 15.9 UP 15.83 UP 15.6 UP 15.59 UP 15.59 UP 15.58 UP 15.51 UP 15.46 UP 15.41 U P 15.33 UP 3.04E-04 2.77E-05 4.39E-05 2.41 3.31 E-04 2.99E-05 1.34E-04 9. 39E-05 2. 38E-05 2.31 2.09 NM_1 99169 NM_002559 NM_032148 Homo sapiens transmembrane, prostate androgen induced RNA (TMEPAI), transcript variant 2, mRNA Homo sapiens purinergic receptor P2X, ligandgated ion channel, 3 (P2RX3), mRNA Homo sapiens solute carrier family 41, member 2 (SLC41A2), mRNA BC021684 Homo sapiens, clone IMAGE:-3827252, mRNA BF000009 7h15g04.xl NCICGAPCol6 Homo sapiens clDNA clone IMAGE:3316086 3, mRNA sequence NM_000147 NM_001252 NM_01 3322 Homo sapiens fucosidase, alpha-L- 1, tissue (FUCAlI), mRNA Homo sapiens tumor necrosis factor (ligand) superfamily, member 7 (TNFSF7), mRNA Homo sapiens sorting nexin 10 (SNX10), 15.31 UP 14.88 UP 14.84 UP 9.99E-04 1.85E-04 2.64E-05 24/05/06,15735 speci gp, 154 155 IND ct mRNA NM_022440 NM_178470 NM_001873 Homo sapiens mal, T-cell differentiation protein (MAL), transcript variant d, mRNA Homo sapiens WOD repeat domain 40B (WDR4OB), mRNA Homo sapiens carboxypeptidase E (CPE), mRNA 14.65 UP 14.53 UP 14.51 U P 14.46 UP 2.14E-04 3.34E-05 6.23E-05 1.64E-05 BM71 9937 UI-E-EJO-ahu-a-1 0-0-Ul. ri UI-E-EJO Homo sapiens cODNA clone UI-E-EJO-ahu-a-10-0-UI mRNA sequence NM_032551 T53523 NM_173354 NM_014585 N38753 NM_001710 Homo sapiens G protein-coupled receptor 54 (GPR54), mRNA ya89h12.rl Stratagene placenta (#937225) Homo sapiens cONA clone IMAGE:68903 mRNA sequence Homo sapiens SNF1l-like kinase (SNF1iLK), mRNA Homo sapiens solute carrier family 40 (ironregulated transporter), member 1 (SLC4OA1), mRNA yy42dOl si Soares melanocyte 2NbHM Homo sapiens cDNA clone IMAGE273889 3, mRNA sequence Homo sapiens B-factor, properdin mRNA 14.45 UP 14.42 UP 5.64E-04 1.81 E-04 14.19 UP 14.17 UP 14.02 UP 13.95 UP 13.9 UP 13.88 UP 5.72E-05 4.06E-05 1.15E-05 2.05E-04 4.45E-04 2.56E-04 BC038556 Homo sapiens, clone IMAGE:3446976, mRNA AK125608 Homo sapiens cODNA FLJ43620 fis, clone SPLEN2O217O1, highly similar to HLA CLASS I HISTOCOMPATIBILITY ANTIGEN, A-2 ALPHA CHAIN PRECURSOR AW24851 6 2820632.3prime NIH_MGC_7 Homo sapiens cDNA clone IMAGE:2820632 3, mRNA 13.79 UP 2.22E-04 24/05/06,15735 speci gp, 155 156sequence NM_000600 Homo sapiens interleukin 6 (interferon, beta 2) (IL6), mRNA AK125852 Homo sapiens cONA FLJ43864 fis, clone TEST14007799 BM728728 UI-E-EO1 -aiv-c-02-0-UI .rl UI-E-EO1 Homo sapiens cDNA clone UI-E-EO1-aiv-c-02-0-UI mRNA sequence 13.62 UP 13.46 UP 13.46 UP 1 .64E-05 1.66E-04 2.77 E-04 NM_018650 NM_022154 Homo sapiens MAP/microtubule affinityregulating kinase 1 (MARKi), mRNA Homo sapiens solute carrier family 39 (zinc transporter), member 8 (SLC39A8), mRNA 13.45 UP 13.39 UP 13.23 UP 4.39E-05 4.78 3.11 AA908815 og77h08.sl NCICGAP_0v8 Homo sapiens cDNA clone IMAGE:1454367 3, mRNA sequence NM_016463 Homo sapiens CXXC finger 5 (CXXC5), mRNA ABOl 1538 Homo sapiens mRNA for MEGF5, partial cds CA4 13744 Ul-H-EZO-bat-h-1 2-0-u Isi NCICGAPChi Homo sapiens cONA clone UI-H-EZO-bat-h-12- 0-UI 3, mRNA sequence BM71 2072 Ul-E-DW1 -ahc-b-1 1-0-UI .rl UI-E-DW1 Homo sapiens cDNA clone UI-E-DW1 -ahc-b-1 1 -0-UI mRNA sequence BU727096 UI-E-CRO-ach-e-1 2-0-UI.sl UI-E-CRO Homo sapiens cDNA clone UI-E-CRO-ach-e-12-0-UI 3, mRNA sequence 13.22 UP 13.19 UP 13.17 UP 13.16 UP 13.14 UP 9.67E-05 3.38E-04 2.09E-05 9.39E-05 4.30E-05 NM_032858 Homo sapiens hypothetical protein FLJ 14904 (FLJ14904), mRNA 13.09 UP 12.92 UP 1 .83E-05 8.39E-06 BU729783 UI-E-CK1 -afh-h-1 8-0-Ulsi U l-E-CK1 Homo sapiens cDNA clone UI-E-CK1 -afh-h-1 8-0-Ul 3, mRNA sequence 24/05/06,15735 spca gp, 1 56 157- AB011095 Homo sapiens mRNA for KIAA0523 protein, partial cds BC033116 Homo sapiens chromodomain helicase DNA binding protein 7, mRNA (cDNA clone IMAGE:3352674), partial cds CB135276 K-EST0187371 L5HLK1 Homo sapiens cDNA clone L5HLK1-32-B12 5, mRNA sequence NM_182920 NM_000236 NM_152694 Homo sapiens a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9 (ADAMTS9), transcript variant 1, mRNA Homo sapiens lipase, hepatic (LIPC), mRNA Homo sapiens zinc finger, CCHC domain containing 5 (ZCCHC5), mRNA 12.91 UP 12.87 UP 12.75 UP 12.73 UP 12.71 UP 12.66 UP 12.51 UP 3.44E-04 2.31E-05 4.93E-05 9.10E-05 1.16E-03 4.93E-05 2.31E-04 AB020640 Homo sapiens mRNA for KIAA0833 protein, partial cds NM_018330 NM_000064 NM_152864 Homo sapiens KIAA1598 (KIAA1598), mRNA Homo sapiens complement component 3 (C3), mRNA Homo sapiens chromosome 20 open reading frame 58 (C20orf58), mRNA 12.46 UP 12.42 UP 12.4 UP 12.4 UP 6.01E-05 5.12E-04 1.66E-03 3.71E-05 AW591723 xt85h10.x1 NCI_CGAP_Utl Homo sapiens cDNA clone IMAGE:2793283 3 similar to contains element MER32 repetitive element;, mRNA sequence NM_152768 NM_152366 Homo sapiens hypothetical protein FLJ25378 (FLJ25378), mRNA Homo sapiens kelch/ankyrin repeat containing cyclin Al interacting protein (KARCA1), transcript variant 1, mRNA 12.28 UP 12.19 UP 2.03E-05 2.62E-05 24/05/06,15735 speci gp, 15 7 158 AW300043 xs45a09.xl NCICGAPKid 11 Homo sapiens cODNA clone IMAGE:2772568 3, mRNA sequence 12.13 UP 2.31 NM_006741 NM_024726 NM_194284 Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1A (PPP1 RiA), mRNA Homo sapiens IQ motif containing with AAA domain (IQCA), mRNA Homo sapiens claudin 23 (CLDN23), mRNA 12.12 UP 12.08 UP 12.02 UP 12 UP 11.95 UP 2.10E-04 5. 33E-03 2.87E-05 1 .48E-04 3.59E-04 AL049974 Homo sapiens mRNA; cIDNA DKFZp564B222 (from clone DKFZp564B222) A1420213 te92g09.xl NCICGAPPr28 Homo sapiens cODNA clone IMAGE:2094208 3, mRNA sequence NM_002800 Homo sapiens proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional protease 2) (PSMB9), transcript variant 1, mRNA 11.85 UP 11.85 UP 4.69E-05 3.64E-05 CA391258 csl3alO.xl Human Retinal pigment epithelium/choroid cIDNA (Un-normalized, unamplified): cs Homo sapiens cODNA clone csl 3alO0 3, mRNA sequence NM_013430 NM_199169 NM_032471 NM_016269 Homo sapiens gamma-glutamnyltransferase 1 (GGT1), transcript variant 3, mRNA Homo sapiens transmembrane, prostate androgen induced RNA (TMEPAI), transcript variant 2, mRNA Homo sapiens protein kinase (cAMPdependent, catalytic) inhibitor beta (PKIB), transcript variant 3, mRNA Homo sapiens lymphoid enhancer-binding 11.79 UP 11.79 UP 11.73 UP 11.72 UP 1 .38E-04 8.39E-06 1 .2811-04 4.57E-05 24/05/06,15735 speci gp. 138 -159 factor 1 (LEFi), mRNA NM_003851 NM_003236 Homo sapiens cellular repressor of ElAstimulated genes 1 (CREGi), mRNA Homo sapiens transforming growth factor, alpha (TGFA), mRNA 11.61 UP 11.61 UP 11.59 UP 1 .83E-05 6.51 1.89E-05 BX1 10418 BX1 10418 NCICGAPKid3 Homo sapiens cONA clone I MAGp998C224 149 IMAGE:1635405, mRNA sequence NM_006033 NM_025151 Homo sapiens lipase, endothelial (LIPG), mRNA Homo sapiens RABi 1 family interacting protein 1 (class 1) (RABi 1 FIPi), transcript variant 1, mRNA 11.55 UP 11.5 UP 8.79E-04 2.65E-05 B1759570 603046987F1 NIHMGC_1 16 Homo sapiens cONA clone IMAGE:5187285 5, mRNA sequence 11.49 UP 3.71 NM_013261 Homo sapiens peroxisome proliferative activated receptor, gamma, coactivator 1, alpha (PPARGC1A), mRNA 11.3 UP 11.29 UP 2.83E-04 8.65E-04 A1830524 wh52c02.xl NCICGAPKidi 1 Homo sapiens cDNA clone IMAGE:2384354 3, mRNA sequence NM_139161 Homo sapiens crumbs homolog 3 (Drosophila) (CRB3), transcript variant 2, mRNA AK055362 Homo sapiens cDNA FLJ30800 fis, clone FEBRA2001 197 BF055156 7j75f03.xl SoaresNSFF8_9WOTPAPSi Homo sapiens cDNA clone IMAGE:3392285 3, mRNA sequence BC016962 Homo sapiens, clone IMAGE:4182947, mRNA 11.15 UP 11.13 UP 11.11 UP 11.05 UP 1 .22E-04 1.02E-05 4.94E-04 1.06E-04 24/05/06,15735 speci gp.159 160- AY358775 Homo sapiens clone DNA1 70212 WGAR9166 (UNQ9166) mRNA, complete cds NM_1 75056 Homo sapiens hypothetical protein LOCi 31 368 (L0C131368), mRNA A1311296 ta48dl O.x2 NCl_CGAP_Lu25 Homo sapiens cDNA clone IMAGE:2047315 3, mRNA sequence AW296834 Ul-H-B312-ahz-a-1 0-0-UI Si0 NCI_CGAP_Sub4 Homo sapiens cDNA clone IMAGE:2728243 3, mRNA sequence 11.05 UP 10.98 UP 10.93 UP 10.91 UP 10.89 UP 10.88 UP 10.87 UP 10.87 UP 2.32E-04 1 .33E-03 2.19E-04 1. 71 E-04 3.87E-04 3.05E-04 2.09E-04 5.06E-05 NM_014464 Homo sapiens tubulointerstitial nephritis antigen (TI NAG), mRNA AK024270 Homo sapiens cDNA FLJ14208 fis, clone NT2RP3003264 H00617 yj25f02.sl Soares placenta Nb2HP Homo sapiens cONA clone IMAGE: 149787 3, mRNA sequence AK126467 Homo sapiens cDNA FLJ44503 fis, clone UTERU3001 158 NM_1 81847 NM_014751 N70752 NM_005302 Homo sapiens amphoterin induced gene 2 (AMIGO2), mRNA Homo sapiens metastasis suppressor 1 (MTSS1), mRNA za72d02.sl Soares-fetal-lungNbHLI 9W Homo sapiens clDNA clone IMAGE:298083 3, mRNA sequence Homo sapiens G protein-coupled receptor 37 (endothelin receptor type B-like) (GPR37), mRNA Homo sapiens toll-like receptor 2 (TLR2), mRNA 10.86 UP 10.86 UP 10.84 UP 10.84 UP 8.91 E-04 2.68E-05 1 .34E-04 2.63E-03 NM_003264 10.83 UP 1.01 E-04 24/05/06,15735 speci gp, 160 161 NM_017594 Homo sapiens DIRAS family, GTP-binding RAS-like 2 (DIRAS2), mRNA A1688800 wd4lbO3.xl Soares_NFL_T_GBC_SI Homo sapiens cODNA clone IMAGE:2330669 3, mRNA sequence 10.81 UP 10.8 UP 10.8 UP 10.79 UP 7.23E-04 H08012 y191b08.r1 Soares infant brain 1iNIB Homo sapiens cDNA clone IMAGE:45474 5, mRNA sequence 8.56E-04 3.26E-04 1 .88E-05 AW014126 UI-H-BIO-aaj-a-05-0-UI.s1 NCICGAPSubi Homo sapiens cODNA clone IMAGE:2709393 3, mRNA sequence NM_014422 H62713 Homo sapiens phosphatidlylinositol (4,5) bisphosphate 5-phosphatase, A transcript variant 1, mRNA yr28c08.rl Soares fetal liver spleen 1 NFILS Homo sapiens cDNA clone IMAGE:206606 similar to gb:X01683 ALPHA-1-ANTITRYPSIN PRECURSOR (HUMAN);, mRNA sequence 10.73 UP 10.73 UP 10.65 UP 10.64 UP 10.63 UP 4.47E-05 1.01 E-03 4.82E-03 5.59E-05 3.90E-04 A1870547 wl47a04.xl NCl_CGAP_Uti Homo sapiens cODNA clone IMAGE:2428014 3, mRNA sequence NM_025202 N78460 Homo sapiens EF hand domain containing 1 (EFHDI), mRNA yz76h06.rl Soares multiple-sclerosis_2NbHMSP Homo sapiens cODNA clone IMAGE:289019 5, mRNA sequence Homo sapiens activation-induced cytidine deaminase (AlCODA), mRNA Homo sapiens hypothetical protein FLJ39553 (FLJ39553), mRNA NM_020661 NM_1 73549 10.63 UP 10.57 UP 7.27E-05 3.11 E-04 24/05/06,15735 speci 8p, 1 6 1 162- IND Ct A1767472 wh27a07.xl NCICGAPKidi 1 Homo sapiens cDNA clone IMAGE:2381940 3 similar to contains L1.t3 Li repetitive element;, mRNA sequence 10.56 UP 8.39E-06 NM_145804 NM_013230 NM_000758 Homo sapiens ankyrin repeat and BTB (POZ) domain containing 2 (ABTB32), mRNA Homo sapiens CD24 antigen (small cell lung carcinoma cluster 4 antigen) (CD24), mRNA Homo sapiens colony stimulating factor 2 (g ran ulocyte-macrophage) (CSF2), mRNA 10o55 UP 1.41 E-06 AB032945 Homo sapiens mRNA for KIAA1 119 protein, partial cds NM_024572 NM_1 81332 NM_022128 Homo sapiens UDP-N-acetyl-alpha-Dgalactosamine:polypeptide Nacetylgalactosaminyltransferase 14 (GaINAc- T14) (GALNT14), mRNA Homo sapiens neuroligin 4, X-linked (NLGN4X), transcript variant 2, mRNA Homo sapiens ribokinase (RBKS), mRNA 10.54 UP 10.51 UP 10.48 UP 10.46 UP 10.46 UP 10.45 UP 10.39 UP 1. 12 E-04 7.66E-04 1.32E-03 2.62E-04 1 .95E-04 2.73E-05 2.36E-05 AB046810 Homo sapiens mRNA for KlAAI 590 protein, partial cds NM_022168 NM_1 53715 Homo sapiens interferon induced with helicase C domain 1 (IFIM), mRNA Homo sapiens homeo box AlO0 (HOXA1O0), transcript variant 2, mRNA 10.38 UP 10.37 UP 10.35 UP 2.83E-05 5.50E-05 1 .25E-03 3.60 E-04 1 .57E-04 BF090392 QV3-NT0023-120900-324-b04 NT0023 Homo sapiens cDNA, mRNA sequence NM_000880 NM_018650 Homo sapiens interleukin 7 mRNA Homo sapiens MAP/microtubule affinityregulating kinase 1 (MARKi), mRNA 10.34 UP 10.29 UP 24/05/06,15735 Speci gp, 162 163 NM_017899 NM_032367 NM_012206 Homo sapiens hypothetical protein FLJ20607 (TSC), mRNA Homo sapiens zinc finger, BED domain containing 3 (ZBED3), mRNA Homo sapiens hepatitis A virus cellular receptor 1 (HAVCR1), mRNA 10.27 UP 10.27 UP 10.23 UP 10.21 UP 6.79E-04 4.12E-05 8.15E-04 1 .92E-03 AK092245 Homo sapiens cDNA FLJ34926 fis, clone NT2RP7003319, highly similar to Mus musculus neuralin mRNA NM_031469 Homo sapiens SH3 domain binding glutamic acid-rich protein like 2 (SH3BGRL2), mRNA 10.18 UP 10.15 UP 1 .63E-05 1 .89E-05 CA31 1343 UI-CF-FNO-aff-b-19-0-UI.sl UI-CF-FNO Homo sapiens cONA clone UI-CF-FNO-aff-b-1 3, mRNA sequence NM_030923 Homo sapiens hypothetical protein DKFZp566N034 (DKFZP566NO34), mRNA 10.15 UP 10.14 UP 2.23E-05 2M0E-04 AK024261 Homo sapiens cDNA FLJ14199 fis, clone NT2RP300271 3 NM_174900 NM_198495 Homo sapiens zinc finger protein 42 (ZFP42), mRNA Homo sapiens CTAGE family, member 4 (CTAGE4), mRNA BX1 05791 BX1 05791 Soares-testisNHT Homo sapiens cDNA clone I MAGp9981101824 IMAGE:742737, mRNA sequence A1672441 waO3cO3.xl NClCGAPKidI 11 Homo sapiens cDNA clone IMAGE:2296996 3, mRNA sequence AK002097 Homo sapiens cDNA FLA11235 fis, clone PLACE 1008488 10.1 UP 10.07 UP 10.06 UP 10.05 UP 10.01 UP 5.14E-05 4.65E-05 2.15E-03 2.40E-04 2.75E-05 24/05/06,15735 speci gp, 163 -164- 6X647256 Homo sapiens mRNA; clDNA DKFZp6B6KO753 (from clone DKFZp686K0753) AK092456 Homo sapiens clDNA FLJ35137 fis, clone PLACE600941 9 9.97 UP 9.96 UP 1.81 E-03 5.02E-05 NM_001853 NM_004946 NM_005139 NM_002260 Homo sapiens collagen, type IX, alpha 3 (COL9A3), mRNA Homo sapiens dedicator of cytokinesis 2 (DOCK2), mRNA Homo sapiens annexin A3 (ANXA3), mRNA Homo sapiens killer cell lectin-like receptor subfamily C, member 2 (KLRC2), mRNA 9.96 UP 9.94 UP 9.92 UP 9.92 UP 9.89 UP 9.85 UP BX649112 Homo sapiens mRNA; cONA DKFZp686EO21O9 (from clone DKFZp686E02109) AK127437 Homo sapiens cONA FLJ45529 fis, clone BRTHA2027546 2.87 3.94E-05 5.14E-05 5.95E-04 6.13E-05 2.09E-05 1.33E-03 4.12E-05 1 .54E-04 NM_080659 NM_014867 Homo sapiens similar to RIKEN cDNA 231 0030G06 gene (MGC1 4839), mRNA Homo sapiens KIAA071 1 gene product (KIAAO71 mRNA 9.81 UP 9.81 u p 9.7 UP BG149255 nad25dOl xl NCI_CGAP_Lu24 Homo sapiens cIDNA clone IMAGE:3366553 3, mRNA sequence AK022598 Homo sapiens cONA FLJ 12536 fis, clone NT2RM4000265 A1792 194 ovO3cO2.y5 NCICGAPKid3 Homo sapiens clDNA clone IMAGE: 1636226 5, mnRNA sequence 9.7 UP 9.65 UP 1 .38E-02 6.10OE-04 NM_005502 Homo sapiens ATP-binding cassette, subfamily A (ABC1), member 1 (ABCA1), mRNA 9.65 UP 4.03E-04 24/05/06,15735 speci gp, 164 165 BE070450 QV4-BT0407-020300-1 22-d08 BT0407 Homo sapiens cDNA, mRNA sequence 9.62 UP 5.52E-05 NM_006255 NM_005114 Homo sapiens protein kinase C, eta (PRKCH), mRNA Homo sapiens heparan sulfate (glucosamine) 1 (HS3ST1), mRNA AK123427 Homo sapiens cDNA FLJ41433 fis, clone BRHI P2007307 9.56 UP 9.55 UP 9.46 UP 9.4 UP 9.4 UP 2.09E-05 1 .44E-04 1.99E-04 1.15E-04 3.08E-05 NM_013430 Homo sapiens gamma-glutamyltransferase 1 (GGT1), transcript variant 3, mRNA AK094353 Homo sapiens cDNA FLJ37034 fis, clone BRACE201 1478 NM_016584 NM_002089 NM 032023 D62831 Homo sapiens interleukin 23, alpha subunit p19 (IL23A), mRNA Homo sapiens chemokine (C-X-C motif) ligand 2 (CXCL2), mRNA Homo sapiens Ras association (RaIGDS/AF-6) domain family 4 (RASSF4), transcript variant 1, mRNA HUM33OB12B Clontech human aorta polyA+ mRNA (#6572) Homo sapiens cONA clone GEN-33012 5, mRNA sequence 9.38 UP 9.38 UP 9.38 UP 9.32 UP 9.31 U P 3.77E-05 4.55E-04 5.39E-05 9.48E-05 8.57E-04 A1963999 wt87g07.xl NCICGAPGC6 Homo sapiens cDNA clone IMAGE:2514492 3, mRNA sequence NM_005978 NM_006622 NM_033495 Homo sapiens S100 calcium binding protein A2 (S100A2), mRNA Homo sapiens polo-like kinase 2 (Drosophila) (PLK2), mRNA Homo sapiens kelch-like 13 (Drosophila) 9.31 U P 9.3 UP 9.25 UP 1 .64E-05 2.93 2.38E-05 24/05/06,15735 speci gp, 16 -166- (KLHL13), mRNA L07615 Human neuropeptide Y receptor Y1 (NPYY1) 9.23 UP 1.09E-03 mRNA, exon 2-3 and complete cds NM_018076 Homo sapiens armadillo repeat containing 4 9.16 UP 5.96E-04 (ARMC4), mRNA CA778369 ipl 7fO3.yl HR85 islet Homo sapiens cDNA 9.12 UP 5.40E-05 clone IMAGE:6217493 5, mRNA sequence NM_024554 Homo sapiens piggyBac transposable element 9.12 UP 2.63E-04 derived 5 (PGBD5), mRNA NM_182487 Homo sapiens olfactomedin-like 2A 9.04 UP 1.64E-04 (OLFML2A), mRNA T78754 ydOlfO8.rl Soares infant brain 1iNIB Homo 9.01 UP 1.09E-03 sapiens cIDNA clone IMAGE:24180 5, mRNA sequence NM_004024 Homo sapiens activating transcription factor 3 9 UP 1.50E-03 (ATF3), mRNA NM_030583 Homo sapiens matrilin 2 (MATN2), transcript 8.98 UP 2.15E-04 variant 2, mRNA NM_145032 Homo sapiens F-box and leucine-rich repeat 8.97 UP 1.78E-05 protein 13 (FBXL1 mRNA NM_020130 Homo sapiens chromosome 8 open reading 8.93 UP 4.79E-04 frame 4 (C8orf4), mRNA NM_005737 Homo sapiens AIDP-ribosylation factor-like 7 8.87 UP 1 .79E-04 (ARL7), mRNA BG675167 602621444F1 NCICGAPSkn3 Homo sapiens 8.86 UP 7.41 E-04 cONA clone IMAGE.4755106 5, mRNA sequence NM_194463 Homo sapiens ring finger protein 128 8.85 UP 8.97E-05 (RNF128), transcript variant 1, mRNA NM_018349 Homo sapiens multiple C2-domains with two 8.81 U P 8.37E-05 24/05/06,15735 speci gp, 166 167transmembrane regions 2 (MCTP2), mRNA AK026740 Homo sapiens cONA: FLJ23087 fis, clone LNG06994, highly similar to AF161368 Homo sapiens HSPC105 mRNA 8.8 UP 3.17E-04 NM_000693 NM_005459 Homo sapiens aldehyde dehydrogenase 1 family, member A3 (ALDH 1A3), mRNA Homo sapiens guanylate cyclase activator 1C (GUCAl mRNA 8.78 UP 8.77 UP 8.74 UP 8.69 UP BF509074 Ul-H-B14-aou-b-08-0-Ul sl NCICGAPSub8 Homo sapiens cDNA clone IMAGE:3086150 3, mRNA sequence AL117425 Homo sapiens mRNA; cDNA DKFZp566L2O3 (from clone DKFZp566L2O3) NM_006257 NM_005567 NM_1 73508 Homo sapiens protein kinase C, theta (PRKCQ), mRNA Homo sapiens lectin, galactoside-binding, soluble, 3 binding protein (LGALS3BP), mRNA Homo sapiens solute carrier family 35, member F3 (SLC35F3), mRNA 8.64 UP 8.64 UP 8.62 UP 8.48 UP 8.48 UP 8.48 UP 4.72E-04 1.57E-04 2.11 2.83E-04 1 .78E-05 1 .26E-05 1 .04E-04 7.96E-05 1.94E-04 6.82E-05 AK025281 Homo sapiens cONA: FLJ21628 fis, clone COL08076 NM_145252 Homo sapiens similar to common salivary protein 1 (L0C124220), mRNA A1764969 wh57b02.xl NClCGAPKidi 1 Homo sapiens cDNA clone IMAGE:238481 1 3, mRNA sequence NM_002313 NM_017641 Homo sapiens actin binding LIM protein 1 (ABLIMi), transcript variant 1, mRNA Homo sapiens kinesin family member 21A (KIF21A), mRNA 8.48 UP 8.42 UP 3.03E-05 2.43E-05 24/05/06,15735 speci gp, 167 168 AA564703 nj22h06.sl NCI_CGAP_AAI Homo sapiens 8.4 UP 6.11 clDNA clone IMAGE:993275 3, mRNA sequence NM_001323 Homo sapiens cystatin E/M (CST6), mRNA 8.37 UP 1.02E-04 NM_014333 Homo sapiens immunoglobulin superfamily, 8.35 UP 1.82E-03 member 4 (IGSF4), mRNA NM_022454 Homo sapiens SRY (sex determining region 8.33 UP 6.04E-05 box 17 (SOX17), mRNA NM_000186 Homo sapiens complement factor H (CFH), 8.32 U P 1.06E-03 mRNA BF512544 UI-H-Bw1-amf-c-08-0-UI.sl NCICGAPSub7 8.31 U P 1.09E-04 Homo sapiens cDNA clone IMAGE:3069687 3, mRNA sequence AF036977 Homo sapiens clone HCG IV.9 unknown mRNA 8.27 UP 1.12E-03 AK095500 Homo sapiens cODNA FLJ38181 fis, clone 8.19 UP 6.56E-05 FCBBF1 000125 NM_001955 Homo sapiens endothelin 1 (EDNi), mRNA 8.18 UP 4.43E-04 NM_002053 Homo sapiens guanylate binding protein 1, 8.17 UP 8.39E-06 interferon-inducible, 67kDa (GBP1), mRNA NM_031476 Homo sapiens hypothetical protein 8.12 UP 8.06E-04 DKFZp434BO44 (DKFZP434BO44), mRNA AA844712 ai70el12.sl Soares-testisNHT Homo sapiens 8.11 UP 2.36E-04 cDNA clone IMAGE: 1376206 3, mRNA sequence BM976385 Ul-CF-EN 1-acz-f-03-0-UI.sl UI-CF-EN 1 Homo 8.11 UP 7.27E-04 sapiens cIDNA clone UI-OF-EN 1-acz-f-03-0-U I 3, mRNA sequence BX647876 Homo sapiens mRNA; cDNA DKFZp313A1 525 8.11 UP 6.87E-04 (from clone DKFZp31 3A1 525) NM_001845 Homo sapiens collagen, type IV, alpha 1 8.06 UP 2.72E-05 24/05106,15735 speci gp. 168 169 (COL4A1), mRNA NM_014900 NM_203306 Homo sapiens COBL-like 1 (COBLL-1), mRNA Homo sapiens hypothetical protein MGC39606 (MGC39606), mRNA 8.04 U P 7.98 UP 7.97 UP 9.67E-05 1 .95E-03 2.73E-05 B1963896 ie66c06.xl Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cONA clone IMAGE:5671691 3, mRNA sequence NM_005025 Homo sapiens serine (or cysteine) proteinase inhibitor, dlade I (neuroserpin), member 1 (SERPIN1l), mRNA 7.97 UP 7.96 UP 3.03E-05 4.75E-05 AK024238 Homo sapiens cDNA FLJ14176 fis, clone NT2RP20031O1 NM_005951 Homo sapiens metallothionein 1 H (MT1 H), mRNA 7.95 UP 7.93 UP 3.19E-03 4.30E-05 CF887677 UI-CF-FNO-aev-o-22-1 8-UI. ri 8 UI-CF-FNO Homo sapiens cODNA clone UI-CF-FNO-aev-o- 22-18-Ul 5, mRNA sequence NM_024423 Homo sapiens desmocollin 3 (DSC3), transcript variant Dsc3b, mRNA A1355761 qt94all1.xl NCICGAPCol4 Homo sapiens cIDNA clone IMAGE:1962908 3 similar to gb:X74929 KERATIN, TYPE 11 CYTOSKELETAL 8 (HUMAN);, mRNA sequence BF445031 nad2OfO2.xl NOICGAPLu24 Homo sapiens cDNA clone IMAGE:3366266 3, mRNA sequence CA444471 UI-H-DPO-avv-a-16-0-UI.sl NCI CGAP Fsl Homo sapiens cODNA clone UI-H-DPO-avv-a-16- 0-UI 3, mRNA sequence 7.91 U P 7.91 U P 7.91 U P 7.89 UP 1.23E-04 6.82E-05 1.78E-05 7.69E-05 NM_014942 Homo sapiens ankyrin repeat domain 6 7.89 UP 2.49E-05 24/05/06,15735 speci gp, 169 170 (ANKRD6), mRNA AK021801 Homo sapiens cDNA FLA11739 fis, clone HEM BA1 005497 NM_001766 NM_005360 NM_018700 Homo sapiens CD1lD antigen, d polypeptide (CIDlD), mRNA Homo sapiens v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) (MAF), mRNA Homo sapiens tripartite motif-containing 36 (TRIM36), mRNA 7.86 UP 7.85 UP 7.81 U P 7.8 UP 7.79 UP 1.15 E-04 5.1 OE-04 7.59E-05 2.55E-05 2.59E-05 BX640643 Homo sapiens mRNA;, cDNA DKFZp686O241 14 (from clone DKFZp686O241 14) NM_005331 NM_1 94298 Homo sapiens hemoglobin, theta 1 (HBQ1), mRNA Homo sapiens solute carrier family 16 (monocarboxylic acid transporters), member 9 (SLC16A9), mRNA Homo sapiens glutaminyl-peptide cyclotransferase (glutaminyl cyclase) (QPCT), mRNA Homo sapiens follistatin-like 3 (secreted glycoprotein) (FSTL-3), mRNA 7.77 UP 7.77 UP 3.73E-04 2.66E-04 NM_012413 7.76 UP 4.60E-04 NM_005860 AB033029 Homo sapiens mRNA for KIAA1 203 protein, partial cds NM_012216 NM_018986 Homo sapiens midline 2 (MID2), transcript variant 1, mRNA Homo sapiens SH3 domain and tetratricopeptide repeats 1 (SH3TC1), mRNA 7.76 UP 7.7 UP 7.62 UP 7.61 U P 7.58 UP 2.64E-05 8.39E-06 6.12E-05 8.69E-04 4.09E-05 BM6651 01 UI-E-CQ1 -aew-l-09-0-UlJ.sl Ul-E-CQ 1 Homo sapiens cDNA clone Ul-E-CQ1 -aew-l-09-0-Ul 3, 24/05/06,15735 speci gp,1 7 0 171 mRNA sequence AL706653 DKFZp686E1543_ri 686 (synonym: hlcc3) Homo sapiens cODNA clone DKFZp686E1543 mRNA sequence BF920409 QV2-NT01 44-0711 00-463-b06 NT01 44 Homo sapiens cDNA, mRNA sequence 7.57 UP 7.55 UP 2.36E-05 6.70E-04 NM_1 73462 NM_031419 NM_016423 NM_020859 NM_004932 NM_1 82797 Homo sapiens papilin, proteoglycan-like sulfated glycoprotein (PAPLN), mRNA Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta (NFKBIZ), transcript variant 1, mRNA Homo sapiens zinc finger protein 219 (ZNF219), mRNA Homo sapiens Shroom-related protein (ShrmL), mRNA Homo sapiens cadherin 6, type 2, K-cadherin (fetal kidney) (CDH6), mRNA Homo sapiens phospholipase C, beta 4 (PLCB4), transcript variant 2, mRNA 7.55 UP 7.55 UP 7.53 UP 7.52 UP 7.52 UP 7.52 UP 7.5 UP 7.47 UP 7.45 UP 7.45 UP 7.43 UP 7.4 UiP 5.64E-05 1 .49E-04 1.71 1.26E-05 1 .64E-05 5.49E-05 6.17E-05 2.32E-05 1 .72E-05 1.19E-03 5.18E-04 4.98E-05 AL512697 Homo sapiens mRNA; cDNA DKFZp547F134 (from clone DKFZp547F134) BC0351 16 Homo sapiens cDNA clone IMAGE:52631 77, partial cds AL353944 Homo sapiens mRNA; cODNA DKFZp761J1 112 (from clone DKFZp761 J1112) NM_152780 Homo sapiens hypothetical protein FLJ 14503 (FLJ14503), mRNA AA888443 nw74flO.sl NCICGAPPrl2 Homo sapiens cONA clone IMAGE: 1252363, mRNA sequence AW450938 Ul-H-B13-all-g-05-0-Ul.sl NCICGAPSubS 24/05/06.15735 speci gp, 171 172- NM_053039 NM_016946 Homo sapiens cDNA clone IMAGE:2737329 3, mRNA sequence Homo sapiens UDP glycosyltransferase 2 family, polypeptide B28 (UGT2B328), mRNA Homo sapiens Fl 1 receptor (Fl 1 transcript variant 1, mRNA 7.38 UP 7.36 UP 7.36 UP 7.34 UP 1.12E-03 4.65E-05 1.15E-04 2.20E-04 AW969742 EST381820 MAGE resequences, MAGK Homo sapiens cONA, mRNA sequence BX1 17866 BX1 17866 NCICGAPGCBl Homo sapiens cONA clone IMAGp998N233105; IMAGE:1234774, mRNA sequence NM_005739 Homo sapiens RAS guanyl releasing protein 1 (calcium and DAG-regulated) (RASGRP1), mRNA 7.31 U P 7.25 UP 2.20E-04 3.52E-05 CB047287 NISCgg~l hOl.yl NCICGAPKidl Homo sapiens cONA clone IMAGE:3253464 5, mRNA sequence NM_013951 Homo sapiens paired box gene 8 (PAX8), transcript variant PAX8B3, mRNA 7.25 UP 7.24 UP AK125695 Homo sapiens cDNA FLJ43707 fis, clone TESOP2001 865 NM_020796 Homo sapiens sema domain, transmembrane domain and cytoplasmic domain, (semaphorin) 6A (SEMA6A), mRNA BM929354 UI-E-EJ 1-aje-o-1 9-0-U ri UI-E-EJ I Homo sapiens cDNA clone UI-E-EJ 1-aje-o-1 9-0-IJI mRNA sequence BX103949 BX1 03949 NCI_CGAP_Co3 Homo sapiens cDNA clone IMAGp998C1 12296; IMAGE:923842, mRNA sequence 7.21 U P 7.19 UP 7.16 UP S 00 1 .62E-03 1.01 E-04 5.49E-05 6.37E-05 NM_003475 Homo sapiens chromosome 11 open reading 7.14 UP 1 .56E-04 24/05/06,15735 speci gp, 172 173frame 13 (Cllorfl3), mRNA BE735115 601566084F1 NIHMGC_21 Homo sapiens cDNA clone IMAGE:3840837 5, mRNA sequence 7.12 UP 1.41 E-03 NM_207517 Homo sapiens ADAMTS-like 3 (ADAMTSL3), mRNA BU688263 UI-CF-EC1-aea-g-1 1-0-Ul-si UI-CF-EC1 Homo sapiens cDNA clone UI-CF-EC1 -aea-g-1 1 -0-UI 3, mRNA sequence AK022971 Homo sapiens cONA FLJ 12909 fis, clone NT2RP2004400 7.11 UP 7.06 UP 7.06 UP 7.05 UP 7.04 UP 7.03 UP 1 .26E-05 2.97E-05 7.80E-05 1.81 E-04 5.64 E-04 1 .56E-03 NM_001740 NM_022073 Homo sapiens calbindin 2, 29kDa (cairetinin) (CALB2), transcript variant CALB2, mRNA Homo sapiens egi nine homolog 3 elegans) (EGLN3), mRNA BX1 17230 BX1 17230 NCICGAPKidl Homo sapiens cDNA clone IMAGp998I235695; IMAGE:2298718, mRNA sequence NM_002230 Homo sapiens junction plakoglobin (JUP), transcript variant 1, mRNA AK023793 Homo sapiens cONA EUJ13731 fis, clone PLACE3000142 AL117598 Homo sapiens mRNA; cONA DKFZp564H1663 (from clone DKFZp564H1663) 7.03 UP 7.02 UP 7 UP 6.99 UP 6.97 UP 6.97 UP 2.78E-05 4.04E-04 1 .59E-04 5. 20E-04 4.47E-04 8.39E-04 NM_001958 NM_007029 Homo sapiens eukaryotic translation elongation factor 1 alpha 2 (EEF1A2), mRNA Homo sapiens stathmin-like 2 (STMN2), mRNA BE968596 601649770F1 NIHMGC_74 Homo sapiens cDNA clone IMAGE:3933472 5, mRNA sequence 24/05/06,15735 speci gp, 173 174- AK126467 Homo sapiens cONA FLJ44503 fis, clone UTERU3001 158 AA832510 oe62d06.sl NCI_CGAP_Lu5 Homo sapiens cDNA clone IMAGE: 1416203 3, mRNA sequence CF137545 UI-HF-BNO-ane-d-05-0-UI.rl NIHMGC_50 Homo sapiens cDNA clone IMAGE:3092384 mRNA sequence 6.97 UP 6.93 UP 6.93 UP 3.82E-05 9.67E-04 2.70 E-03 NM_004895 NM_018424 NM_004390 NM_024603 Homo sapiens cold autoinflamnmatory syndrome 1 (CIASi), transcript variant 1, mRNA Homo sapiens erythrocyte membrane protein band 4.1 like 4B (EPB41L1413), mRNA Homo sapiens cathepsin H (CISH), transcript variant 1, mRNA Homo sapiens hypothetical protein FLJ 11588 (FLJ1 1588), mRNA 6.9 UP 6.9 UP 6.89 UP 6.87 UP 6.82 UP 1 .46E-03 4.68E-05 2.72E-05 3.80E-05 8.39E-04 A1492941 qz42h08.xl NCICGAPKidi 1 Homo sapiens cDNA clone IMAGE:2029599 3, mRNA sequence NM_003985 Homo sapiens tyrosine kinase, non-receptor, 1 (TNK1), mRNA AK095399 Homo sapiens cDNA FLJ38080 fis, clone CTONG2016185 BQ020597 UI-H-DPO-avd-a-1 3-0-Ulsi NCICGAPEsi Homo sapiens cDNA clone IMAGE:5877780 3, mRNA sequence 6.8 UP 6.8 UP 6.8 UP 4.55E-05 9.23E-04 4.53E-05 NM_001432 NM_005485 Homo sapiens epiregulin (EREG), mRNA Homo sapiens poly (ADP-ribose) polymerase family, member 3 (PARP3), transcript variant 2, mRNA 6.77 UP 6.76 UP 1.25E-05 6.46E-05 24/05/06,15735 speci gp, 174 175 Ct AB058769 Homo sapiens mRNA for KIAA1 866 protein, partial cds BU753362 U I-i-1 -air-h-09-O-UI si NCI_CGAP_P15 Homo sapiens cONA clone UI-1-BB11-air-h-09- 0-UI 3, mRNA sequence AL834140 Homo sapiens mRNA; cIDNA DKFZp434A2029 (from clone DKFZp434A2029) BX092501 BX092501 NCI_CGAP_Lu5 Homo sapiens clDNA clone I MAGp998K1 43946 IMAGE: 1557637, mRNA sequence BX640973 Homo sapiens mRNA; cDNA DKFZp686B15184 (from clone DKFZp686B1 5184) 6.76 UP 6.75 UP 6.73 UP 6.71 U P 6.71 U P 9.84E-05 1.08E-04 4.49E-05 2.56E-04 2.36E-04 NM_015277 NM_021192 NM_032621 X02851 NM_014258 NM_000682 Homo sapiens neural precursor cell expressed, developmentally down-regulated 4-like (NEDD4L), mRNA Homo sapiens homeo box D1l1 (HOXIDl 1), mRNA Homo sapiens brain expressed X-Iinked 2 (BEX2), mRNA Human mRNA for interleukin-1 precursor (pre IL-I) Homo sapiens synaptonemnal complex protein 2 (SYCP2), mRNA Homo sapiens adrenergic, alpha-2B-, receptor (AIDRA2B3), mRNA 6.7 UP 6.69 UP 6.69 UP 6.68 UP 6.68 UP 1.60E-05 8.94E-04 1 .83E-04 3.32E-04 4.96E-02 6.67 UP 6.64 UP 3.64E-05 1.64E-04 BQ435580 AGENCOURT_7836890 NIHMGC_82 Homo sapiens cODNA clone IMAGE:61 02371 5, mRNA sequence NM_024608 Homo sapiens nei endonuclease VIII-like 1 (E. coli) (NEII-l), mRNA 6.63 UP 3. 23E-05 24/05/06,15735 speci gp, 175 176- AK057113 Homo sapiens cDNA FLJ32551 fis, clone 6.63 UP 6.06E-04 SPLEN 1000087 NM_130897 Homo sapiens dynein, cytoplasmic, light 6.62 UP 2.40E-03 polypeptide 28 (DINCL21B), mRNA N39597 yy5leO4.sl 6.62 UP 8.33E-04 Soares multiple-sclerosis_2NbHMSP Homo sapiens cDNA clone IMAGE:277086 3, mRNA sequence BU616749 UI-H-FH1-bfj-a-11-0-UI.s1 NCICGAPFH1 6.59 UP 1.93E-04 Homo sapiens cDNA clone UI-H-FH1-bfj-a-1 1- 0-UI 3, mRNA sequence AW195474 xn38g09.xl NCICGAPKidi 1 Homo sapiens 6.59 UP 6.82E-05 cDNA clone IMAGE:2696032 3, mRNA sequence AK127437 Homo sapiens cONA FLJ45529 fis, clone 6.57 UP 1.76E-04 BRTHA2027546 NM_004717 Homo sapiens diacylglycerol kinase, iota 6.56 UP 7.54E-05 (DGKI), mRNA BU584197 2513030T6 LIVRTUT04 Homo sapiens cONA 6.53 UP 8.82E-04 clone 2513030 3, mRNA sequence BU634363 UlJ-H-FL1-bgx-o-20-0-UI.sl NCICGAPFLi 6.53 UP 1.24E-04 Homo sapiens cONA clone UI-H-FL1-bgx-o-20- 0-UI 3, mRNA sequence NM_178868 Homo sapiens chemokine-like factor super 6.52 UP 1.59E-03 family 8 (CKLFSF8), mRNA NM_002247 Homo sapiens potassium large conductance 6.49 UP 4.49E-05 calcium-activated channel, subfamily M, alpha member 1 (KCNMA1), mRNA AW1 88195 xj93e12.xl SoaresNFLTGBCSi Homo 6.49 UP 3.81 sapiens cDNA clone IMAGE:2664814 3 similar to contains element THR repetitive element;, 24/05/06,15735 speci gp,1 76 177mRNA sequence NM_153634 Homo sapiens copine Vill (CPNE8), mRNA 6.48 UP 1.72E-04 NM_145205 Homo sapiens HMG2 like (L0C127540), mRNA 6.47 UP 6.39E-05 NM_178868 Homo sapiens chemokine-like factor super 6.47 UP 1.15E-05 family 8 (CKLFSF8), mRNA U63828 Human tissue plasminogen activator mRNA, 6.46 UP 5.51 partial cds NM_004529 Homo sapiens myeloid/lymphoid or mixed- 6.46 UP 8.21 lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (MLLT3), mRNA BX647655 Homo sapiens mRNA; clDNA DKFZp451A21 1 6.46 UP 6.94E-05 (from clone DKFZp451 A21 1) AW470401 xz83gOl xl NCIOGAPLu24 Homo sapiens 6.46 UP 1.30E-04 clDNA clone IMAGE:2870832 3 similar to contains L1.t2 Li repetitive element;, mRNA sequence BG570144 602591134F1 NIHMGC_77 Homo sapiens 6.45 UP 1.08E-03 clDNA clone IMAGE:4717761 5, mRNA sequence BX115325 BX1 15325 NCICGAPKidl Homo sapiens 6.45 UP 1.04E-04 clDNA clone IMAGp998K085276; IMAGE:21 37855, mRNA sequence NM_002214 Homo sapiens integrin, beta 8 (ITGB8), mRNA 6.44 UP 6.77E-05 CA314926 UI-CF-FNO-afi-b-19-0-UlJ.sl IJI-CF-FNO Homo 6.43 UP 6.61 sapiens clDNA clone U I-CF-FN0-afi-b-1 9-0-Ul 3, mRNA sequence AK093870 Homo sapiens clDNA FLJ36551 fis, clone 6.43 UP 1.28E-03 TRACH2008 127 NM_000860 Homo sapiens hydroxyprostag land in 6.42 UP 1.76E-05 dehydrogenase 15-(NAD) (HPGD), mRNA 24/05/06,15735 speci gp. 1 77 178 A1831 068 wj62d12.xl NCICGAPLul9 Homo sapiens cDNA clone IMAGE:2407415 3, mRNA sequence 6.41 U P 1 .37E-04 NM_000349 NM_014181 NM_024534 NM_002843 Homo sapiens steroidlogenic acute regulator (STAR), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA Homo sapiens HSPC1 59 protein (HSPC1 59), mRNA Homo sapiens hypothetical protein EUJ12684 (FLJ12684), mRNA Homo sapiens protein tyrosine phosphatase, receptor type, J (PTPRJ), mRNA 6.41 U P 6.4 UP 6.38 UP 6.38 UP 6.37 UP 1 .26E-04 1.67E-04 6.57E-04 1.32E-03 7.01 E-03 A1926616 wo48e04.xl NCICGAPGas4 Homo sapiens cDNA clone IMAGE:2458590 3 similar to contains MER27.b2 MER27 repetitive element mRNA sequence NM_002273 NM_207303 Homo sapiens keratin 8 (KRT8), mRNA Homo sapiens attractin-like 1 (ATRNL-1), mRNA AK001 007 Homo sapiens cDNA FLJ10145 fis, clone HEMBA1003322 CB047092 NlSCgfO8fO3.xl NCICGAPKidl2 Homo sapiens cDNA clone IMAGE:3253013 3, mRNA sequence BC060805 Homo sapiens hypothetical protein FLJ 12788, mRNA (cDNA clone IMAGE:5266931), partial cds A1359782 qy4l hl O.xl NCICGAP_8rn23 Homo sapiens cDNA clone IMAGE:2014627 3, mRNA sequence CA426602 UI-H-FE1-bef-f-11-0-UI.sl NCICGAPFEl Homo sapiens cDNA clone UI-H-FE1-bef-f-1 1- 6.36 UP 6.35 UP 6.35 UP 6.33 UP 6.31 U P 6.31 U P 6.29 UP 2.91 E-03 7.85E-04 1.82E-05 6.92E-05 2.93E-05 3.23E-04 2.14E-04 24/05/06,15735 speci gp, 178 -179 0-UI 3, mRNA sequence AK091686 Homo sapiens cODNA FLJ34367 fis, clone FEBRA201 6621 AK091336 Homo sapiens cIDNA FLJ34017 fis, clone FCBBF2002626 6.27 UP 6.26 UP 1.93 E-03 5.49E-05 NM_015068 R79128 H08785 Homo sapiens paternally expressed 10 (PEGlO), mRNA yi86c12.rl Soares placenta Nb2HP Homo sapiens cDNA clone IMAGE:146134 5, mRNA sequence yl94f04.sl Soares infant brain 1INIB Homo sapiens cDNA clone IMAGE:45882 3, mRNA sequence 6.26 UP 6.23 UP 6.22 UP 6.21 U P 4.53E-05 2.04E-04 1 .66E-03 4.58E-03 A1953708 wq47d09.xl NGI_OGAP_GC6 Homo sapiens cODNA clone IMAGE:2474417 3, mRNA sequence NM_015236 Homo sapiens latrophilin 3 (LPHN3), mRNA AL833609 Homo sapiens mRNA; cODNA DKFZp686O1267 (from clone DKFZp686O1267) AK127421 Homo sapiens cDNA FLJ45513 fis, clone BRTHA2021450 NM_015085 NM_001305 NM_173078 Homo sapiens GTPase activating Rap/RanGAP domain-like 4 (GARNL4), mRNA Homo sapiens claudin 4 (CLDN4), mRNA Homo sapiens SLIT and NTRK-like family, member 4 (SLITRK4), mRNA 6.2 UP 6.19 UP 6.19 UP 6.18 UP 6.17 UP 6.16 UP 6.16 UP 5.35E-04 7.53E-04 4.68E-05 6.82E-05 3.48E-05 1 .08E-03 1 .20E-04 BG165745 602344592F1 NIHMGC_89 Homo sapiens clDNA clone IMAGE:4454470 5, mRNA sequence NM_006074 Homo sapiens tripartite motif-containing 22 6.15 UP 1. 15E-03 24/05/06,15735 speci gp, 179 180- (TRIM22), mRNA NM_005928 Homo sapiens milk fat globule-EGE factor 8 protein (MFGE8), mRNA BF939703 nac8OeO7.xl NCICGAPBrn23 Homo sapiens cDNA clone IMAGE:3440725 3 similar to contains MER3O.t3 MER30 repetitive element;, mRNA sequence BX115301 BX1 15301 NCICGAPKid5 Homo sapiens cONA clone 1MAGp998J093989; IMAGE:1574120, mRNA sequence 6.15 UP 6.12 UP 6.11 UP 1 .63E-02 6.35E-05 8.26E-05 NM_018849 NM_015478 NM_015669 NM_147189 Homo sapiens ATP-binding cassette, subfamily B (MOR/TAP), member 4 (ABCB4), transcript variant B, mRNA Homo sapiens l(3)mbt-like (Drosophila) (L3MBTL), transcript variant 1, mRNA Homo sapiens protocadherin beta 5 (PCDHB5), mRNA Homo sapiens hypothetical protein MGC39325 (MGC39325), mRNA BQ018133 UI-H-DPO-avv-l-18-0-UI.sl NCICGAPEsi Homo sapiens cDNA clone IMAGE:5884961 3, mRNA sequence 6.09 UP 6.09 UP 6.08 UP 6.06 UP 6.06 UP 6.04 UP 6.03 UP 6.02 UP 6 UP 3.23E-05 2.43E-05 7.52E-05 3.18E-04 1 .78E-05 8.29E-05 6.87E-05 2.66E-05 2.55E-04 N34295 NM_006472 NM_012472 yy~lelO.sl Soares multiple-sclerosis_2NbHMSP Homo sapiens oDNA clone IMAGE:277098 3, mRNA sequence Homo sapiens thioredoxin interacting protein (TXNIP), mRNA Homo sapiens leucine rich repeat containing 6 (LRRC6), mRNA AK123319 Homo sapiens cDNA FLJ41 325 fis, clone 24/05/06,15735 speci gp.!SO 181 BRAMY2046871 AK123807 Homo sapiens cDNA FLJ41 813 fis, clone NT2R12O1 1450 5.98 UP 7.92E-05 NM_017786 NM_000212 NM_000817 Homo sapiens hypothetical protein FLJ20366 (FLJ20366), mRNA Homo sapiens integrin, beta 3 (platelet glycoprotein lila, antigen CD61) (ITGB3), mRNA Homo sapiens glutamate decarboxylase 1 (brain, 67kDa) (GADi), transcript variant GAD67, mRNA 5.98 UP 5.97 UP 5.96 UP 5.92 U P 5.91 U P 1 .85E-03 2.73E-05 9.94E-03 1.38E-03 3.68E-04 AK123617 Homo sapiens cDNA FLJ41623 fis, clone CTONG3009227 B1493986 dflO6gl2.yl Morton Fetal Cochlea Homo sapiens cDNA clone IMAGE:.253881 5 5, mRNA sequence NM_005264 Homo sapiens GDNF family receptor alpha 1 (GFRA1I), transcript variant 1, mRNA CN478597 UI-CF-FNO-aeo-g-2 1-0-UI.sl UI-CF-FNO Homo sapiens cDNA clone UI-CF-FNO-aeo-g-21 -0-UI1 3, mRNA sequence BQ021695 UI-H-DH1-axi-f-22-0-Ul.sl NCICGAPDH1 Homo sapiens cDNA clone IMAGE:5829141 3, mRNA sequence AL137698 Homo sapiens mRNA; cONA DKFZp434C1915 (from clone DKFZp434C191 partial cds 5.91 U P 5.88 UP 5.88 UP 5.88 UP 5.88 UP 5.87 UP 4.09E-05 1.13E-03 1.72E-04 2.03E-05 1.24E-04 2.88E-05 1.25E-04 NM_014905 Homo sapiens glutaminase (GILS), mRNA AA993234 ot6OaO8.sl Soares-testisNHT Homo sapiens cIDNA clone IMAGE: 1621142 3, mRNA sequence N38890 yy8lfl2.sl 5.87 UP 24/05/06,15735 speci gp,1 8 1 182- NM_197955 NM_014399 NM_024704 NM_002276 Soares multiple-sclerosis_2NbHMSP Homo sapiens cDNA clone IMAGE:279983 3 similar to contains OFRAt3 OFIR repetitive element;, mRNA sequence Homo sapiens normal mucosa of esophagus specific 1 (NMES1), transcript variant 1, mRNA Homo sapiens transmembrane 4 superfamily member 13 (TM4SF13), mRNA Homo sapiens chromosome 20 open reading frame 23 (C20orf23), mRNA Homo sapiens keratin 19 (KRT1 mRNA 00248442 AGENCOURT_14095939 NIHMGC_172 Homo sapiens cDNA 5, mRNA sequence AK024850 Homo sapiens cDNA: FLJ21197 fis, clone COLOO201 5.85 UP 5.84 UP 5.82 UP 5.8 UP 5.79 UP 5.79 UP 5.77 UP 5.77 UP 5.76 UP 5.76 UP 5.75 UP 1.85E-04 2.18E-05 1.24E-04 7.06E-03 2.16E-04 1 .45E-04 1 .37E-02 2.43E-05 2.31 E-04 1.38E-03 6.59E-05 H83499 NM_1 53377 NM_153267 NM_144595 ys9lfl2.rl Soares retina N2b5HR Homo sapiens cDNA clone IMAGE:222191 5, mRNA sequence Homo sapiens leucine-rich repeats and immunoglobulin-like domains 3 (LRIG3), mRNA Homo sapiens MAM domain containing 2 (MAMDC2), mRNA Homo sapiens hypothetical protein FLJ30046 (FLJ30046), mRNA BF5091 55 Ul-H-B14-aov-b-05-0-Ul.sl NOIOGAPSub8 Homo sapiens cDNA clone IMAGE:3086145 3, mRNA sequence NM_002735 NM_025044 Homo sapiens protein kinase, cAMPdependent, regulatory, type 1, beta (PRKAR1 B), mRNA Homo sapiens bicaudal C homolog 1 5.73 UP 5.72 UP 2.73E-05 5.81 24/05/06,15735 speci gp, 182 183 (Drosophila) (BICCi), mRNA BM969191 UI-CF-ENO-acp-e-22-0-UI.sl UI-CF-ENO Homo sapiens cDNA clone UI-CF-ENO-acp-e-22-0-UI 3, mRNA sequence 5.69 UP 1 .67E-03 NM_000203 Homo sapiens iduronidase, alpha-L- (IDUA), mRNA 5.68 UP 5.67 UP 1.l1OE-03 9.23E-04 A1693580 wdl2dOl xl NCI_CGAP_Co3 Homo sapiens cONA clone IMAGE:2327905 3, mRNA sequence NM_006169 H46176 NM_024306 Homo sapiens nicotinamide Nmethyltransferase (NNMT), mRNA yoi4aii1.s1 Soares adult brain N2b5HB55Y Homo sapiens cDNA clone IMAGE: 177884 3, mRNA sequence Homo sapiens fatty acid 2-hydroxylase (FA2H), mRNA 5.66 UP 5.65 UP 5.63 UP 2.1 8E-05 1 .88E-05 4.1 9E-03 BX1 10683 BX1 10683 NCICGAPGC6 Homo sapiens cDNA clone IMAGp998Ei 75727 IMAGE:2310904, mRNA sequence 5.62 U P 7.42E-04 NM_030765 NM_003929 Homo sapiens UDP-GIcNAc:betaGal beta-i 3- N-acetylglucosaminyltransferase 4 (B3GNT4), mRNA Homo sapiens RAB7, member RAS oncogene family-like 1 (RAB7L-1), mRNA 5.58 UP 5.55 UP 5.54 UP 5.54 UP 1 .80E-03 2.14E-05 2.13E-05 4.13E-05 A1220066 qg84dOl.xl SoaresNFLTGBCSi Homo sapiens cONA clone IMAGE:i841857 3, mRNA sequence AA664452 ae94d02.si Human bone marrow stromal cells Homo sapiens cDNA clone IMAGE:i1026723 3 similar to contains element LTR4 repetitive element;, mRNA sequence 24/05/06,13735 speci gp, 183 184- NM_007237 NM_173662 NM_003020 NM_206808 NM_004867 NM_006333 NM_014251 NM_006863 Homo sapiens SP140 nuclear body protein (SP140), transcript variant 1, mRNA Homo sapiens hypothetical protein LOC285533 (LOC285533), mRNA Homo sapiens secretory granule, neuroendocrine protein 1 (7B2 protein) (SGNE1), mRNA Homo sapiens citrate lyase beta like (CLYBL), transcript variant 2, mRNA Homo sapiens integral membrane protein 2A (ITM2A), mRNA Homo sapiens nuclear DNA-binding protein (ClD), transcript variant 1, mRNA Homo sapiens solute carrier family 25, member 13 (citrin) (SLC25A13), mRNA Homo sapiens leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1 (LILRA1), mRNA 5.53 UP 5.52 UP 5.52 UP 5.52 UP 5.51 UP 5.51 UP 5.5 UP 5.49 UP 5.49 UP 5.48 UP 5.47 UP 2.41E-04 3.69E-03 2.08E-04 1.87E-04 2.13E-05 7.84E-04 5.96E-04 6.51E-05 1.85E-03 4.65E-05 1.48E-04 AK057166 Homo sapiens cDNA FLJ32604 fis, clone STOMA1000133 NM_000076 Homo sapiens cyclin-dependent kinase inhibitor 1C (p57, Kip2) (CDKN1C), mRNA BC040701 Homo sapiens cDNA clone IMAGE:5736259, partial cds NM_152765 NM_019034 S81734 Homo sapiens hypothetical protein MGC33510 (MGC33510), mRNA Homo sapiens ras homolog gene family, member F (in filopodia) (RHOF), mRNA tissue transglutaminase homologue {alternatively spliced} [human, erythroleukemia 5.46 UP 5.46 UP 5.46 UP 4.76E-05 2.64E-05 3.92E-05 24/05/06.15735 speci gp,18 4 185 cell line HEL GMO6141A, mRNA, 2362 nt] BM670793 UI-E-DX1 -agv-p-03-0-UI si U l-E-DX1 Homo sapiens cDNA clone UI-E-DX1-agv-p-03-0-UI 3, mRNA sequence 5.46 UP 3.77E-05 NM_002829 Homo sapiens protein tyrosine phosphatase, non-receptor type 3 (PTPN3), mRNA BM7271 51 UI-E-EJO-aij-f-05-0-UI. ri UI-E-EJ0 Homo sapiens cONA clone UI-E-EJO-aij-f-05-0-UI mRNA sequence BF966833 602286668T1 NIHMGC_95 Homo sapiens cONA clone IMAGE:4375360 3, mRNA sequence 5.45 UP 5.45 UP 5.45 UP 4.79E-05 4.13E-05 2.83 NM_004904 Homo sapiens cAMP responsive element binding protein 5 (CREBS), mRNA AA635788 nr32hOl.sl NCI_CGAP_Pr22 Homo sapiens cDNA clone IMAGE: 169713 3 similar to contains Alu repetitive element;, mRNA sequence BM701 989 UI-E-CQ 1-aex-j06-0-UI .ri UI-E-CQ1 Homo sapiens cONA clone UI-E-CQ1-aex-j06-0-UI mRNA sequence 5.44 UP 5.43 UP 5.42 UP 1.09E-04 2.02E-03 7.55E-04 NM_020665 NM_019034 NM_017912 NM_152433 Homo sapiens transmembrane protein 27 (TMEM27), mRNA Homo sapiens ras homolog gene family, member F (in filopodia) (RHOF), mRNA Homo sapiens hect domain and RLD 6 (HERC6), mRNA Homo sapiens kelch repeat and BTB (POZ) domain containing 3 (KBTBD3), transcript 5.4 UP 5.39 UP 5.38 UP 5.37 UP 5.46E-05 5.72E-05 5.85E-05 4.29E-04 variant 1, mRNA CA31 4843 UI-CF-FNO-afi-a-06-0-Ul.sl UI-CF-FNO Homo 5.37 UP 2.05E-04 24/05/06.15735 speci 186 sapiens cDNA clone Ul-CF-FN0-afi-a-06-0-UI 3, mRNA sequence Homo sapiens TNFAIP3 interacting protein 1 (TNIP1), mRNA NM_006058 BU191317 AGENCOURT_8074912 NIHMGC_1 10 Homo sapiens cDNA clone IMAGE:6086274 5, mRNA sequence AL049437 Homo sapiens mRNA; cDNA DKFZp586E1 120 (from clone DKFZp586E1 120) 5.36 UP 5.36 UP 5.34 UP 2.25E-03 4.45E-02 7.78E-04 NM_030952 NM_004170 Homo sapiens likely ortholog of rat SNF1/AMPactivated protein kinase (SNARK), mRNA Homo sapiens solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member I (SLCIAI), mRNA AW269776 xv45b09.xl SoaresNFLTGBCSI Homo sapiens cDNA clone IMAGE:2816057 3, mRNA sequence BM977716 UI-CF-EN1-aef-b-21-0-UI.sl UI-CF-EN1 Homo sapiens cDNA clone UI-CF-ENI1-aef-b-21 -0-UI 3, mRNA sequence AK023658 Homo sapiens cDNA FLJ 13596 fis, clone PLACE 1009637 AF196185 Homo sapiens atypical PKC isotype-specific interacting protein long variant mRNA, complete cd~s AL045014 DKFZp434F134_si 434 (synonym: htes3) Homo sapiens cONA clone DKFZp434F1 34 3, mRNA sequence 5.31 U P 5.31 U P 5.3 UP 5.3 UP 5.29 UP 5.28 UP 5.27 UP 4.21 1.15E-04 1.97E-04 4.01 E-03 6.83E-04 4.57E-05 2.67E-05 NM_004496 Homo sapiens forkhead box Al (FOXAI), mRNA 5.27 UP 2.88E-03 24/05/06,15735 speci gp, 186 187- NM_033132 NM_198182 NM_001657 R92346 Homo sapiens Zic family member 5 (odd-paired homolog, Drosophila) (ZIC5), mRNA Homo sapiens transcription factor CP2-like 2 (TFCP2L2), transcript variant 2, mRNA Homo sapiens amphiregulin (schwannomaderived growth factor) (AREG), mRNA yqO6b1lO.sl Soares fetal liver spleen I NFLS Homo sapiens cDNA clone IMAGE: 196123 3, mRNA sequence BX537539 Homo sapiens mRNA; cDNA DKFZp686A1 130 (from clone DKFZp686A1 130) AB041269 Homo sapiens mRNA for keratin 19, partial cds, isolate: Ki9-1411 BX090717 BX090717 NCI_CGAP_Kid5 Homo sapiens cDNA clone IMAGp998O154699; IMAGE: 1916390, mRNA sequence AK025743 Homo sapiens cDNA: FLJ22090 fis, clone HEP16084 5.26 UP 5.26 UP 5.26 UP 5.25 UP 5.25 UP 5.23 UP 5.2 UP 5.2 UP 5.2 UP 5.2 UP 2.09E-05 1 .35E-02 3.99E-05 1.16E-04 4.80E-04 1.15E-02 9.02E-04 1 .04E-04 3.34E-05 2.40E-04 NM_002413 Homo sapiens microsomal glutathione Stransferase 2 (MGST2), mRNA AA780946 ag99cl 2.sl Gessler Wilms tumor Homo sapiens cDNA clone IMAGE: 1155286 3, mRNA sequence NM_032488 NM_024997 NM_002222 NM_000784 Homo sapiens cornifelin (CN EN), mRNA Homo sapiens activating transcription factor 7 interacting protein 2 (ATF71P2), mRNA Homo sapiens inositol 1,4,5-triphosphate receptor, type 1 (ITPR1), mRNA Homo sapiens cytochrome P450, family 27, subfamily A, polypeptide 1 (CYP27A1I), nuclear 5.2 UP 5.19 UP 5.19 UP 5.17 UP 1 .78E-05 2.40E-03 1.41 E-04 7.39E-03 24/05/06,15735 speci gp. 18 7 188gene encoding mitochondrial protein, mRNA NM_005760 Homo sapiens CCAAT/enhancer binding 5.16 UP 5.52E-05 protein zeta (CEBPZ), mRNA BQ01 1746 UI-1-BC1p-atk-b-09-0-Ul.sl NCICGAPP13 5.16 UP 5.86E-04 Homo sapiens cONA clone UI-1-BC1p-atk-b- 09-0-U I 3, mRNA sequence NM_032728 Homo sapiens chromosome 9 open reading 5.15 UP 1.85E-03 frame 67 (C9orf67), mRNA riNM_005755 Homo sapiens Epstein-Barr virus induced gene 5.15 UP 2.33E-04 3 (EBI3), mRNA AK056852 Homo sapiens cDNA FLJ32290 fis, clone 5.15 UP 1.32E-03 PROST2000463 AK054990 Homo sapiens cONA FLJ30428 fis, clone 5.15 UP 1.85E-03 BRACE2008941 D54580 HUM1 44GO1 B Clontech human fetal brain 5.13 UP 2.03E-04 polyA+ mRNA (#6535) Homo sapiens cDNA clone GEN-144G01 5, mRNA sequence AL1 37535 Homo sapiens mRNA; cONA DKFZp434H2O19 5.13 UP 2.45E-02 (from clone DKFZp434H2019) AL110252 Homo sapiens mRNA; cONA DKFZp566A1O46 5.12 UP 2.19E-03 (from clone DKFZp566A1 046) A1659523 ft99d12.xl NCICGAPPr28 Homo sapiens 5.1 UP 1.16E-03 cDNA clone IMAGE:2249687 3, mRNA sequence AW1 37001 UI-H-Bll-acu-c-05-0-Ul.sl NClCGAPSub3 5.1 UP 6.90E-05 Homo sapiens cONA clone IMAGE:271 5632 3, mRNA sequence BM969331 Ul-CF-DU1-aar-g-23-0-UI.sl UI-OF-DUl Homo 5.08 UP 3.31 E-03 sapiens cONA clone UI-CF-DU1-aar-g-23-0-UI 3, mRNA sequence NM_1 78823 Homo sapiens chromosome 6 open reading 5.08 UP 3.66E-05 24/05/06,15735 speci gp, 1 88 189frame 165 (C6orfl65), mRNA NM_018476 Homo sapiens brain expressed, X-linked 1 (BEXi), mRNA 5.06 UP 5.06 UP 3.05E-05 1 .75E-04 BF107212 6018242901 1 NIHMGC_79 Homo sapiens cIDNA clone IMAGE:4043879 5, mRNA sequence NM_052890 Homo sapiens peptidoglycan recognition protein 2 (PGLYRP2), mRNA 5.05 UP 5.03 UP 3.95E-05 2. 88E-05 BX459043 BX459043 Homo sapiens PLACENTA Homo sapiens cIDNA clone CSODE01 lYN10 3- PRIME, mRNA sequence NM_032857 NM_022746 Homo sapiens lactamase, beta (LACTB), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA Homo sapiens hypothetical protein FLJ22390 (FLJ22390), mRNA AK025909 Homo sapiens cIDNA: FLJ22256 fis, clone HRC02860 5.02 U P 5.02 UP 5.02 UP 5.02 UP 5.01 UP 5.01 UP NM_002247 Homo sapiens potassium large conductance calcium-activated channel, subfamily M, alpha member 1 (KCNMA1), mRNA 1 .76E-05 4.49E-04 4.54E-04 1 .33E-03 2.82E-04 2.18E-05 3. 53E-05 1 .92E-03 A1434849 til3bOl.xl NCI_CGAP_Kidil Homo sapiens cDNA clone IMAGE:2130313 3 similar to contains MER37.bl MER37 MER37 repetitive element;, mRNA sequence AK091933 Homo sapiens clDNA FLJ34614 fis, clone KIDNE2014268 NM_004331 Homo sapiens BCL2!adenovirus El1B l9kDa interacting protein 3-like (BNIP3L), mRNA 5 UP 5 UP ALl 19769 DKFZp761 E1224_ri 761 (synonym: hamy2) Homo sapiens cODNA clone DKFZp761 El 224 24/05/06,15735 spc~i gp,189 190mRNA sequence NM_001451 NM_144594 NM_002421 Homo sapiens forkhead box F1 (FOXF1), mRNA Homo sapiens hypothetical protein FLJ32942 (FLJ32942), mRNA Homo sapiens matrix metalloproteinase 1 (interstitial collagenase) (MMP1), mRNA 465.04 Down 379.94 Down 365.32 Down 2.67E-05 1.12 2.43E-05 AK026784 Homo sapiens cDNA: FLJ23131 fis, clone LNG08502 331.17 Down NM_016307 NM_006350 NM_000089 NM_007036 Homo sapiens paired related homeobox 2 (PRRX2), mRNA Homo sapiens follistatin (FST), transcript variant FST317, mRNA Homo sapiens collagen, type 1, alpha 2 (COL1A2), mRNA Homo sapiens endothelial cell-specific molecule 1 (ESMI), mRNA 309.99 Down 232.51 Down 220.95 Down 217.57 Down 8.46E-06 8.39E-06 8.39E-06 2.96E-05 2.01 AK021543 Homo sapiens cDNA FLA11481 fis, clone HEMBA100 1803 NM_004460 Homo sapiens fibroblast activation protein, alpha (FAP), mRNA 215.51 Down 205.38 Down 190.76 Down 2.31 1.15E-05 1.15 AK122739 Homo sapiens cDNA FLJ 16260 fis, clone 1MR322006947, highly similar to Rattus norvegicus mRNA for dHand protein NM_000474 NM_152270 NM_001884 Homo sapiens twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Drosophila) (TWISTi), mRNA Homo sapiens hypothetical protein FLJ34922 (FLJ34922), mRNA Homo sapiens hyaluronan and proteoglycan 151.94 Down 144.24 Down 134.45 Down 5.23E-06 1 .73E-05 2.18E-05 24/05/06,15735 speci gp. 190 191 INO Ct link protein 1 (HAPLN mRNA NM_000710 NM_021637 NM_006350 NM_000362 NM_002091 NM_000609 NM_032638 NM_198148 Homo sapiens bradykinin receptor B1 (BDKRB1), mRNA Homo sapiens transmembrane protein 35 mRNA Homo sapiens follistatin (FST), transcript variant FST317, mRNA Homo sapiens tissue inhibitor of metalIloprotei nase 3 (Sorsby fundus dystrophy, pseudoinflammatory) (TIMP3), mRNA Homo sapiens gastrin-releasing peptide (GRP), mRNA Homo sapiens chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) (CXCL12), mRNA Homo sapiens GATA binding protein 2 (GATA2), mRNA Homo sapiens carboxypeptidase X (M14 family), member 2 (CPXM2), mRNA 132.74 Down 126.76 Down 106.55 Down 102.59 Down 101.58 Down 97.42 Down 84.58 Down 77.44 Down 77.37 Down 77.09 Down 76.12 Down 72.98 Down 1.18 8.39E-06 2.28E-05 1 .76E-05 2.46E-05 3.48E-05 1 .37E-05 9.50E-05 1 .26E-05 2.65E-05 3.65E-05 1 .25E-05 W38393 zbl 5c07. ri Soares-fetal-lungNbH Li9W Homo sapiens cDNA clone IMAGE:302124 mRNA sequence AL831863 Homo sapiens mRNA; cDNA DKFZp761J2O17 (from clone DKFZp761J2O17) AB067499 Homo sapiens mRNA for KIAA1912 protein, partial cds BX089019 BX089019 Soares-testisNHT Homo sapiens cDNA clone IMAGp998K243513; IMAGE: 1391 375, mRNA sequence A1962169 wq45cl O.xl NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2474226 3, mRNA 65.52 Down 4.53E-05 24/05/06,15735 spedi gp, 191 192 sequence NM_139211 Homo sapiens homeodomain-only protein (HOP), transcript variant 2, mRNA 64.01 Down 1.72 2.35 CD677332 hol 5f06.yl Human Trabecular meshwork cDNA: hohphq Homo sapiens cDNA clone hol Sf06 5, mRNA sequence 63.91 Down NM_001442 NM_205855 W03013 NM_002852 NM_024633 Homo sapiens fatty acid binding protein 4, adipocyte (FABP4), mRNA Homo sapiens HWKM1940 (UNQ194O), mRNA zaO2cO4.rl Soares melanocyte 2NbHM Homo sapiens cDNA clone IMAGE:291 366 5 similar to contains THRAt3 THR repetitive elemnent;, mRNA sequence Homo sapiens pentaxin-related gene, rapidly induced by IL-I beta (PTX3), mRNA Homo sapiens chromosome 14 open reading frame 139 (Cl4orfl39), mRNA 63.47 Down 58.05 Down 53.58 Down 53.13 Down 1.37E-05 1.89E-05 2.67E-06 8.15E-04 3.58E-05 1.09E-04 2.03E-05 4.98E-05 AK021543 Homo sapiens cDNA FLJ1 1481 fis, clone HEMBA1 001803 51.58 Down 51.28 Down 48.32 Down 48.23 Down NM_002593 Homo sapiens procollagen C-endopeptidase enhancer (POOLCE), mRNA A1422199 tf58d04.xl NOICGAPBrn23 Homo sapiens cDNA clone IMAGE:2 103463 3, mRNA sequence NM_014459 NM_016588 NM_012242 NM_000685 Homo sapiens protocadherin 17 (PCDH17), mRNA Homo sapiens neuritin 1 (NRN1), mRNA Homo sapiens dickkopf homolog 1 (Xenopus Iaevis) (DKK1), mRNA Homo sapiens angiotensin 11 receptor, type 1 45.53 Down 44.52 Down 43.26 Down 42.51 Down 2.11 1 .78E-05 7.16E-06 2.57 E-04 24/05/06,15735 spei gp, 192 193 (AGTR1), transcript variant 1, mRNA AK056725 Homo sapiens cDNA FLJ32 163 fis, clone PLACE6000371 Al 124557 am58g02.xl Johnston frontal cortex Homo sapiens cDNA clone IMAGE: 1539794 3, mRNA sequence 42.21 Down 41.42 Down 2.67E-06 8.25E-03 NM_020404 NM_015170 Homo sapiens CD164 sialomucin-like 1 (CD164L-1), mRNA Homo sapiens sulfatase 1 (SULF11), mRNA CA843592 ir49c12.xl HR85 islet Homo sapiens cDNA clone IMAGE:6548544 3, mRNA sequence AY335938 Homo sapiens homeodomain protein IRXA1 (IRX1) mRNA, complete cds 39.82 Down 38.91 Down 37.67 Down 36.92 Down 35.31 Down 2.32E-05 2.36E-05 1 .25E-05 3.15E-05 6.57E-05 NM_002961 Homo sapiens Si100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog) (S100A4), transcript variant 1, mRNA AK091731 Homo sapiens cDNA FLJ34412 fis, clone HEART2002432 34.47 Down 34.03 Down 33.2 Down 2.83E-05 4.55E-05 1.82E-05 NM_006329 Homo sapiens fibulin 5 (FBLN5), mRNA BQ020357 UI-H-EDO-axk-p-07-0-UI.sl NCIOGAPEDO Homo sapiens cDNA clone IMAGE:5830134 3, mRNA sequence NM_018013 NM_002402 Homo sapiens hypothetical protein FLJ 10159 (FLJ1O1 59), mRNA Homo sapiens mesoderm specific transcript homolog (mouse) (MEST), transcript variant 1, mRNA 32.86 Down 32.83 Down 1. 1 2.14E-05 BQ001571 UI-H-DH1-awr-i-18-O-UI.sl NCICGAPDH1 Homo sapiens cDNA clone IMAGE:5893337 3, mRNA sequence 32.34 Down 8.96E-06 24/05/06.15735 speci gp.1 9 3 194- NM_032777 Homo sapiens G protein-coupled receptor 124 (GPR124), mRNA 31.96 Down 1.18E-04 AK124396 Homo sapiens cONA FLJ42405 fis, clone ASTR03000474 NM_002448 NM_000090 NM_001 147 NM_001 146 NM_000576 Homo sapiens msh homeo box homolog 1 (Drosophila) (MSX1), mRNA Homo sapiens collagen, type 111, alpha 1 (Ehlers-Danlos syndrome type IV, autosomal dominant) (COL3A), mRNA Homo sapiens angiopoietin 2 (ANGPT2), mRNA Homo sapiens angiopoietin 1 (ANGPT1), transcript variant 1, mRNA Homo sapiens interleukin 1, beta (ILi mRNA AF0521 15 Homo sapiens clone 23688 mRNA sequence NM_006439 NM_016192 NM_002575 NM_007361 NM_1 52399 NM_203370 Homo sapiens mab-21 -like 2 elegans) (MAB321L-2), mRNA Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 2 (TMEFF2), mRNA Homo sapiens serine (or cysteine) proteinase inhibitor, dlade B (ovalbumin), member 2 (SERPINB32), mRNA Homo sapiens nidogen 2 (osteonidogen) (NID2), mRNA Homo sapiens hypothetical protein FLJ30834 (FLJ30834), mRNA Homo sapiens similar to RIKEN cDNA 6530418L21 (L0C389119), mRNA Homo sapiens GATA binding protein 3 31.36 Down 31.23 Down 29.77 Down 29.68 Down 29.26 Down 29.06 Down 26.15 Down 25.51 Down 25.46 Down 24.67 Down 23.56 Down 23.42 Down 22.99 Down 22.51 Down 2.24E-05 2.03E-05 3.23E-04 2.51 6. 83E-05 1.15E-05 1.15E-05 1.20E-04 2.55E-05 5.40E-05 2.64E-05 6.51 1.43E-05 1.41 E-04 24/05/06,15735 speci gp, 194 195 NM_00100229 (GATA3), transcript variant 1, mRNA AK093256 Homo sapiens cONA FLJ35937 fis, clone TEST1201 1480 U83115 NM_006475 NM_014178 NM_005127 NM_022475 Human non-lens beta gamma-crstallin like protein (AIMi) mRNA, partial cds Homo sapiens periostin, osteoblast specific factor (POSTN), mRNA Homo sapiens syntaxin binding protein 6 (amisyn) (STXBP6), mRNA Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 2 (activation-induced) (CLECSF2), mRNA Homo sapiens hedgehog interacting protein (HHIP), mRNA 22.26 Down 22.18 Down 21.99 Down 21.69 Down 21.46 Down 21.42 Down 3.04E-05 3.77E-05 7.38E-05 3.36E-05 3.71 4.57E-05 4.47E-05 8X1 12628 BX1 12628 Soares-fetal-lungNbHL1 9W Homo sapiens cDNA clone IMAGp998A09669; IMAGE:299024, mRNA sequence 20.99 Down NM_000810 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 5 (GABRA5), mRNA 20.84 Down 20.45 Down 5.50E-05 2.55 BQ934941 AGENCOURT8810373 NIHMGC_101 Homo sapiens cDNA clone IMAGE:6429485 5, mRNA sequence BC071787 Homo sapiens cDNA clone IMAGE:461 0527, partial cds NM_033292 NM_020809 Homo sapiens caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase) (CASPII), transcript variant alpha, mRNA Homo sapiens Rho GTPase activating protein 20.44 Down 19.88 Down 19.54 Down 1 .25E-05 6.18E-05 5.26E-05 24105/06,15735 speci gp,195 196- INO 20 (ARHGAP2O), mRNA BE866150 601679068F1 NIHMGC_53 Homo sapiens cDNA clone IMAGE:3961768 5, mRNA sequence AW021686 df26hl 1.yl Morton Fetal Cochlea Homo sapiens cDNA clone IMAGE:2484717 5, mRNA sequence BX109483 BX109483 NCI_CGAP_0v23 Homo sapiens cDNA clone IMAGp998C165481; IMAGE:2216391, mRNA sequence 19.3 Down 18.86 Down 2.38E-05 2.59E-05 18.74 Down 9.84E-05 NM_001463 Homo sapiens frizzled-related protein (FRZB), mRNA 18.63 Down 2.05E-04 AK128325 Homo sapiens cDNA FLJ46467 fis, clone THYMU3022668 AK096661 Homo sapiens cDNA FLJ39342 fis, clone OCBBF201 8873 18.11 Down 17.95 Down 1.78E-05 5.14E-05 NM_002531 NM_031908 Homo sapiens neurotensin receptor 1 (high affinity) (NTSR1), mRNA Homo sapiens Clq and tumor necrosis factor related protein 2 (C1QTNF2), mRNA 17.64 Down 17.61 Down 17.36 Down 17.31 Down A1085016 ow88e06.sl Soares-fetal-liver spleen_INFLSSI Homo sapiens cDNA clone IMAGE: 1653922 3, mRNA sequence AK095791 Homo sapiens cDNA FLJ38472 fis, clone FEBRA2022 148 5.02E-05 1 .23E-04 4.39E-05 2.76E-04 2.13E-05 6.OOE-04 5.06E-05 NM_020927 NM_024600 NM_012449 Homo sapiens KIAA1 576 protein (KIAA1 576), mRNA Homo sapiens chromosome 16 open reading frame 30 (Cl6orf3O), mRNA Homo sapiens six transmembrane epithelial 17 Down 16.96 Down 16.92 Down 24/05/06,15735 speci gp,196 197 NM_004787 N95448 antigen of the prostate (STEAP), mRNA Homo sapiens slit homolog 2 (Drosophila) (SLIT2), mRNA zb8lel Ilsi Soares-senescent-fibroblastsNbHSF Homo sapiens cDNA clone IMAGE:310028 3, mRNA sequence Homo sapiens serum deprivation response (phosphatidylserine binding protein) (SDPR), mRNA 16.69 Down 16.55 Down 1 .78E-05 1 .72E-05 NM_004657 16.4 Down 1 .60E-05 BC046364 Homo sapiens flavoprotein oxidoreductase MICAL3, mRNA (cDNA clone IMAGE:57371 21), with apparent retained intron 16.35 Down 1. 15E-05 NM_053044 Homo sapiens serine protease HTRA3 (HTRA3), mRNA BQ01 1545 UI-1-BClp-asi-a-02-0-UI.sl NCICGAPP13 Homo sapiens cDNA clone UI-1 -BC 1p-asi-a-02- 0-UI 3, mRNA sequence BC017939 Homo sapiens, clone IMAGE:427571 1, mRNA, partial cds 16.29 Down 16.22 Down 15.98 Down 15.83 Down 3.77E-05 5.21 E-04 5.83E-05 3.04E-05 NM_007289 Homo sapiens membrane metalloendlopeptidlase (neutral endopeptidase, enkephalinase, CALLA, CDlO) (MME), transcript variant 2b, mRNA CA437861 UI-H-DHO-aur-k-1 2-0-UI si NCICGAPDHO Homo sapiens cDNA clone UI-H-DHO-aur-k-12- 0-UI 3, mRNA sequence 15.77 Down 2.56 E-04 NM_006182 NM_145239 Homo sapiens discoidin domain receptor family, member 2 (DDR2), mRNA Homo sapiens similar to lymphocyte antigen 6 complex, locus G5B3; G5b protein; open reading frame 31 (L0C1 12476), mRNA 15.71 Down 15.64 Down 4.79E-05 3.37E-05 24/05/06,15735 speci gp. 1 97 198- H 15096 ym29ellI.rl Soares infant brain 1iNIB Homo sapiens cDNA clone IMAGE:49250 5, mRNA 15.58 Down 2.20E-04 sequence NM_002851 NM_014217 NM_000963 Homo sapiens protein tyrosine phosphatase, receptor-type, Z polypeptide 1 (PTPRZ1), mRNA Homo sapiens potassium channel, subfamily K, member 2 (KCNK2), mRNA Homo sapiens prostag land in-endo peroxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), mRNA 15.57 Down 1 .90E-04 15.13 Down 1. 31 E-04 14.94 Down 1.88E-05 BX1 15659 BX1 15659 Soares-total-fetusNb2HF8_9w Homo sapiens cONA clone IMAGp998C204119 IMAGE:1623883, mRNA sequence 14.81 Down 2.66E-04 NM_002729 Homo sapiens hemnatopoietically expressed homeobox (HHEX), mRNA 14.78 Down 14.73 Down 1.09E-03 3.66E-05 A1082087 oz52h09.xl Soares-senescent-fibroblastsNbHSF Homo sapiens cONA clone IMAGE: 1679009 3, mRNA sequence NM_018431 NM_004791 Homo sapiens docking protein 5 (DOKS), transcript variant 1, mRNA Homo sapiens integrin, beta-like 1 (with EGFlike repeat domains) (ITGBL1), mRNA 14.67 Down 14.42 Down 14.36 Down 14.27 Down 8.15E-04 2.18E-05 5.21 E-04 1 .25E-05 AK021531 Homo sapiens cDNA FLJ1 1469 fis, clone HEMB8A1001658 NM_057179 NM_003619 NM_002518 Homo sapiens twist homolog 2 (Drosophila) (TWIST2), mRNA Homo sapiens protease, serine, 12 (neurotrypsin, motopsin) (PRSS12), mRNA Homo sapiens neuronal PAS domain protein 2 14.1 Down 1.78E-05 14.05 Down 5.49E-05 24/05/06,15735 speci gp, 198 199- (NPAS2), mRNA NM_000396 NM_016206 NM_021643 NM_000955 NM_058187 Homo sapiens cathepsin K (pycnodysostosis) (CTSK), mRNA Homo sapiens colon carcinoma related protein (FLJ38507), mRNA Homo sapiens tribbles homolog 2 (Drosophila) (TRIB2), mRNA Homo sapiens prostaglandin E receptor 1 (subtype EPII), 42kDa (PTGER1I), mRNA Homo sapiens chromosome 21 open reading frame 63 (C2lorf63), mRNA 13.81 Down 13.76 Down 13.62 Down 13.52 Down 13.44 Down 13.26 Down 2.31 E-04 1. 81 E-04 8.39E-06 1 .70E-05 1 .53E-04 8.65E-05 CN479391 UI-H-DF1-aug-f-02-0-UI.s9 NCICGAPDF1 Homo sapiens cDNA clone UI-H-DF1-aug-f-02- 0-UI 3, mRNA sequence NM_006209 NM_005584 Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin) (ENPP2), mRNA Homo sapiens mab-2 1-like 1 elegans) (MAB21L1), mRNA 13.21 Down 12.73 Down 3.28 E-04 1.01 E-04 BM468332 AGENCOURT_6432296 NIHMGC_71 Homo sapiens cDNA clone IMAGE:5535773 5, mRNA 12.64 Down 2.13E-05 sequence NM_020353 NM_031302 NM_005308 NM_032883 Homo sapiens phospholipid scramblase 4 (PLSCR4), mRNA Homo sapiens gycosyltransferase (L0C83468), mRNA Homo sapiens G protein-coupled receptor kinase 5 (GR KS), mRNA Homo sapiens chromosome 20 open reading frame 100 (C20orflOO), mRNA 12.39 Down 12.39 Down 12.28 Down 12.17 Down 2.08E-04 1 .88E-03 1. 18E-04 1 .78E-05 24/05/06,15735 speci gp, 199 200 NM_0001 10 Homo sapiens dihydropyrimidine dehydrogenase (DPYD), mRNA 12.16 Down 2.75E-05 BU536871 AGENCOURT_10224340 NIHMGC_141 Homo sapiens cDNA clone IMAGE:6565454 mRNA sequence 12.05 Down 4.21 NM_016270 NM_005110 Homo sapiens Kruppel-like factor 2 (lung) (KLF2), mRNA Homo sapiens glutamine-fructose-6-phosphate transaminase 2 (GFPT2), mRNA 11.98 Down 11.92 Down 11.81 Down 11.78 Down 1.94E-03 2.93E-05 5.02E-05 2.03E-05 AK1 30711 Homo sapiens cDNA FLJ27201 fis, clone SYNO31 33 BM991890 UI-H-DF1-auk-h-02-0-UI.sl NCICGAPDF1 Homo sapiens cDNA clone IMAGE:5870641 3, mRNA sequence NM_000304 Homo sapiens peripheral myelin protein 22 (PMP22), transcript variant 1, mRNA 11.77 Down 1.04E-03 BM926469 AGENCOURT_6644776 NIHMGC_122 Homo sapiens cDNA clone IMAGE:5766855 5, mRNA sequence 11.53 Down 7.1 6E-06 NM_001424 Homo sapiens epithelial membrane protein 2 (EMP2), mRNA 11.39 Down 5.12E-04 AK093762 Homo sapiens cDNA FLJ36443 fis, clone THYMU2012891 11.18 Down 1 .34E-04 NM_006288 NM_006183 NM_002522 NM_016428 Homo sapiens Thy-i cell surface antigen (THYl), mRNA Homo sapiens neurotensin (NTS), mRNA Homo sapiens neuronal pentraxin I (NPTX1), mRNA Homo sapiens ABI gene family, member 3 (AB13), mRNA 11.17 Down 11.14 Down 11.08 Down 11.03 Down 4.26E-04 8.52E-04 3.03E-04 2.83E-05 24t05(06,15733 speci gp, 200 -201- NM_001769 Homo sapiens CD9 antigen (p24) (CD9), mRNA 11 Down 2.45E-04 AL833655 Homo sapiens mRNA; cDNA DKFZp66700320 (from clone DKFZp66700320) 10.8 Down 10.64 Down 1 .73E-05 1 .04E-04 R56121 yg94d04.sl Soares infant brain 1iNIB Homo sapiens cDNA clone IMAGE:41388 3, mRNA sequence NM_012445 NM_004811 NM_002977 Homo sapiens spondin 2, extracellular matrix protein (SPON2), mRNA Homo sapiens leupaxin (LPXN), mRNA Homo sapiens sodium channel, voltage-gated, type IX, alpha (SCN9A), mRNA 10.63 Down 10.6 Down 10.51 Down 10.5 Down 1 .36E-04 2.09E-05 2.09E-05 3.34E-05 B1598031 603248155F1 NIHMGC_96 Homo sapiens cDNA clone IMAGE:.5300149 5, mRNA sequence NM_1 73553 NM_001311 NM_015916 NM_005595 NM_1 82728 NM_1 52996 Homo sapiens hypothetical protein FLJ25801 (FLJ25801), mRNA Homo sapiens cysteine-rich protein 1 (intestinal) (CRIPi), mRNA Homo sapiens family with sequence similarity 26, member B (FAM26B), mRNA Homo sapiens nuclear factor I/A (NFIA), mRNA Homo sapiens solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 (SLC7A8), transcript variant 2, mRNA Homo sapiens sialyltransferase 7 ((alpha-Nacetylneuraminyl-2,3-beta-galactosyl-1,3)-Nacetyl galactosaminide alpha-2,6sialyltransferase) C (SIAT7C), mRNA 10.49 Down 10.31 Down 10.28 Down 10. 12 Down 9.98 Down 9.95 Down 9.92 Down 2.32E-05 2.73E-05 1 .59E-04 7.43E-04 6.78E-05 1 .25E-05 2.31 AK091713 Homo sapiens cDNA FLJ34394 fis, clone 24/05/06,15735 speci gp, 20 1 202 HCH0N2000676 AK022877 Homo sapiens cDNA FLJ12815 fis, clone NT2RP2002546 NM_1 94250 Homo sapiens similar to C630007C1 7Rik protein (L0C91752), mRNA BC039450 Homo sapiens, clone IMAGE:531 1619, mRNA NM_031894 Homo sapiens ferritin, heavy polypeptide-like 17 (FTHL17), mRNA B1561641 603256058171 NIHMGC_97 Homo sapiens cDNA clone IMAGE:5298374 5, mRNA sequence BC028245 Homo sapiens, Similar to hypothetical gene LOCi 30797, clone IMAGE:5395354, mRNA NM_031957 Homo sapiens keratin associated protein 1-5 mRNA 9.89 Down 9.84 Down 9.77 Down 9.76 Down 9.68 Down 9.68 Down 9.66 Down 9.56 Down 9.55 Down 9.51 Down 9.46 Down 9.36 Down 9.3 Down 9.25 Down 3.15E-05 7.08E-05 2.60E-04 5.99E-04 1.96E-03 1.88E-05 2.31 4.34E-05 1. 17E-04 2.09E-05 4.1 2.14E-05 6.77E-05 3. 10 E-04 AA947461 ok2OfO3.sl SoaresNSFF8_9WOTPAP_51 Homo sapiens cDNA clone IMAGE: 1508381 3, mRNA sequence AK127309 Homo sapiens cDNA FLJ45377 fis, clone BRHIP301 9956 NM_016247 NM_005574 NM_004369 NM_003973 NM_000459 Homo sapiens interphotoreceptor matrix proteoglycan 2 (IMPG2), mRNA Homo sapiens LIM domain only 2 (rhombotinlike 1) (LMO2), mRNA Homo sapiens collagen, type VI, alpha 3 (COL6A3), transcript variant 1, mRNA Homo sapiens ribosomal protein L14 (RPL14), mRNA Homo sapiens TEK tyrosine kinase, endothelial 24Y0S106,1S735 speci gp, 202 203 (venous malformations, multiple cutaneous and mucosal) (TEK), mRNA Homo sapiens podocalyxin-like (PODXL), NM_005397 9.06 Down mRNA BU675964 UI-CF-DUI-aaf-b-24-0-UI.sl UI-CE-DUl Homo sapiens cDNA clone UI-CF-DU 1 -aaf-b-24-0-UI 3, mRNA sequence A1640484 wa27fOl xl NCICGAPKidi 1 Homo sapiens cONA clone IMAGE:2299321 3, mRNA sequence 6.52E-04 6.82E-05 9 Down 8.92 Down 8. 54E-05 NM_030781 NM_001998 Homo sapiens collectin sub-family member 12 (COLEC1 transcript variant 11, mnRNA Homo sapiens fibulin 2 (FBLN2), transcript variant 2, mRNA 8.54 Down 8.53 Down 8.51 Down 8.51 Down 8.65E-05 4.60E-04 4.85E-04 8.23E-05 BC039369 Homo sapiens, clone IMAGE:5271073, mRNA, partial cds AA436084 zuO3aO2.rl Soares-testisNHT Homo sapiens cDNA clone IMAGE:730730 5 similar to contains element PTR5 PTR5 repetitive element;, mRNA sequence NM_015192 NM_024420 Homo sapiens phospholipase C, beta 1 (phosphoinositide-specific) (PLCB1), transcript variant 1, mRNA Homo sapiens phospholipase A2, group IVA (cytosolic, calcium-dependent) (PLA2G4A), mRNA 8.48 Down 8.48 Down 8.42 Down 2.34E-04 2.23E-03 7.38E-05 BX095887 BX095887 Soares-total-fetusNb2HF8_9w Homo sapiens cDNA clone IMAGp998G 124121 IMAGE: 1624739, mRNA sequence NM_006417 Homo sapiens interferon-induced protein 44 (IF144), mRNA 8.37 Down 2.46E-04 24/05/06,15735 speci gp. 2 0 3 204 AK022033 Homo sapiens cDNA FLJ 11971 fis, clone HEMBB1001208 N69782 NM_023003 yz6ObO7.sl Morton Fetal Cochlea Homo sapiens cDNA clone IMAGE:287413 3, mRNA sequence Homo sapiens transmembrane 6 superfamily member 1 (TM6SF1), mRNA 8.35 Down 8.02 Down 7.93 Down 7.86 Down 2.06E-04 2.78 E-04 1 .20E-04 2.31 BC036034 Homo sapiens endothelial differentiation, lysophosphatid ic acid G-protein-coupled receptor, 2, transcript variant 2, mRNA (cDNA clone MGC:33157 IMAGE:5272431), complete NM_005602 Homo sapiens claudin 11 (oligodendrocyte transmembrane protein) (CLDN1 mRNA 7.84 Down 7.74 Down 7.72 Down 2.43E-02 3.04E-05 3.59E-05 BC039676 Homo sapiens, clone IMAGE:5173389, mRNA BC030692 Homo sapiens ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen mRNA (cDNA clone MGC:26319 IMAGE:4826082), complete cds NM_01 5278 NM_031283 Homo sapiens SAM and SH3 domain containing 1 mRNA Homo sapiens transcription factor 7-like 1 (Tcell specific, HMG-box) (TCF7L-1), mRNA BC042378 Homo sapiens, clone IMAGE:5277693, mRNA 7.58 Down 7.57 Down 7.56 Down 7.49 Down 7.48 Down 7.43 Down 1 .38E-04 4.12E-05 9.91 E-04 5.18E-03 2.05E-04 2.31 NM_013363 NM_005923 R53688 Homo sapiens procollagen C-endopeptidase enhancer 2 (PCOLCE2), mRNA Homo sapiens mitogen-activated protein kinase kinase kinase 5 (MAP3K5), mRNA yg84h04.rl Soares infant brain 1iNIB Homo sapiens cDNA clone IMAGE:.40175 5, mRNA sequence 24/05/06,15735 speci gp,204 -205- A1216469 qh07hl0.xl SoaresNFLTGBCSi Homo sapiens cONA clone IMAGE: 1844035 3, mRNA sequence 7.28 Down 4.92E-05 NM_014331 NM_138801 Homo sapiens solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 (SLC7A1 mRNA Homo sapiens galactose mutarotase (aldose 1epimerase) (GALM), mRNA AL049443 Homo sapiens mRNA; cDNA DKFZp586N2020 (from clone DKFZp586N2O2O) NM_005328 NM_006072 NM_020987 Homo sapiens hyaluronan synthase 2 (HAS2), mRNA Homo sapiens chemokine (C-C motif) ligand 26 (CCL26), mRNA Homo sapiens ankyrin 3, node of Ranvier (ankyrin G) (AN K3), transcript variant 1, mRNA 7.27 Down 7.24 Down 7.22 Down 7.17 Down 7.12 Down 7.09 Down 7.08 Down 7.07 Down 2.76E-03 5.50E-05 2.83E-04 3.96E-03 6.86E-05 7.31 4.47E-05 7.52E-04 BX647541 Homo sapiens mRNA; cDNA DKFZp686P0492 (from clone DKFZp686P0492) A1417595 tg79h09.xl SoaresNhHMPuSi Homo sapiens cONA clone IMAGE:21 15041 3, mRNA sequence AA1 58235 zo76b02.sl Stratagene pancreas (#937208) Homo sapiens cDNA clone IMAGE:592779 3, mRNA sequence 7.06 Down 1 .52E-04 NM_005583 Homo sapiens lymphoblastic leukemia derived sequence 1 (LYUl), mRNA BU570253 AGENCOURT_10401698 NIHMGC_82 Homo sapiens cDNA clone IMAGE:661 8451 5, mRNA sequence BM675371 UI-E-EJO-aht-a-07-0-UI .sl UI-E-EJO Homo sapiens cDNA clone Ul-E-EJO-aht-a-07-0-UI 3, 7.03 Down 7 Down 6.95 Down 4.69E-05 2.35E-04 4.53E-05 24/05/06,15735 speci gp. 2 0 206 mRNA sequence AK024653 Homo sapiens cDNA: FLJ21 000 fis, clone CAE03359 W31037 zb86c06.rl Soares-senescent-fibroblastsNbHSF Homo sapiens cDNA clone IMAGE:310474 5, mRNA sequence AL831835 Homo sapiens mRNA; cDNA DKFZp547A0515 (from clone DKFZp547AO515) 6.93 Down 6.91 Down 6.9 Down 6.85 Down 6.85 Down 6.82 Down 6.82 Down 6.77E-05 4.95E-05 1 .53E-03 3. 34E-05 3.88E-02 6.89E-05 4.58E-03 NM_001849 NM_007084 NM_025107 Homo sapiens collagen, type VI, alpha 2 (COL6A2), transcript variant 2C2, mRNA Homo sapiens SRY (sex determining region Y)box 21 (SOX21), mRNA Homo sapiens myc target 1 (MYCTi), mRNA AA393981 zt58a03.rl Soares-testisNHT Homo sapiens cDNA clone IMAGE:726508 5, mRNA sequence NM_170744 Homo sapiens unc-5 homolog B elegans) (UNC5B3), mRNA AL1 33118 Homo sapiens mRNA; cDNA DKFZp586NO121 (from clone DKFZp586NO121) AK090603 Homo sapiens cDNA FLJ33284 fis, clone ASTR02009458 6.82 Down 6.78 Down 6.76 Down 9.92E-04 1 .42E-03 1 .36E-04 4.93E-05 1.06E-04 9.75E-04 NM_002203 NM_003713 NM_001401 Homo sapiens integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) (ITGA2), mRNA Homo sapiens phosphatidic acid phosphatase type 2B (PPAP2B), transcript variant 1, mRNA Homo sapiens endothelial differentiation, lysophosphatidic acid G-protei n-cou pled receptor, 2 (EDG2), transcript variant 1, mRNA 6.74 Down 6.73 Down 6.69 Down 24/05/06,15735 speci gp,206 -207- NM_020226 N71 963 Homo sapiens PR domain containing 8 (PRDM8), mRNA yz95e03.sl Soares melanocyte 2NbHM Homo sapiens cDNA clone IMAGE:290812 3 similar to contains Alu repetitive element;, mRNA 6.68 Down 6.63 Down 2.31 E-04 2.47E-04 sequence AK127536 Homo sapiens cDNA FLJ45629 fis, clone CH0NS2000797, highly similar to T-box transcription factor TBX1 6.6 Down 1.09E-04 NM_006206 NM_016559 NM_012307 R34294 N36786 Homo sapiens platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), mRNA Homo sapiens peroxisomal biogenesis factor 5like (PEX5L), mRNA Homo sapiens erythrocyte membrane protein band 4.1 -like 3 (EPB341L-3), mRNA yh84bOl si Soares placenta NbHIP Homo sapiens cDNA clone IMAGE: 136393 3, mRNA sequence yy34e08.sl Soares melanocyte 2NbHM Homo sapiens cDNA clone IMAGE:273158 3 similar to contains element MSR1 repetitive element;, mRNA sequence 6.55 Down 6.55 Down 6.51 Down 6.49 Down 6.49 Down 6.44 Down 6.43 Down 6.30E-04 6.77E-04 9.62E-04 2.78E-05 6.12E-05 8.41 9.06E-05 BX1 13851 BX1 13851 Soares-total-fetusNb2HF8_9w Homo sapiens cDNA clone IMAGp998G0541 16 IMAGE:11622812, mRNA sequence BG484952 602503960F1 NIHMGC_77 Homo sapiens cDNA clone IMAGE:4617278 5, mRNA sequence NM_005434 Homo sapiens BENE protein (BENE), mRNA 6.4 Down 6.39 Down 1 .64E-05 4.12E-05 BX1 06577 BX1 06577 Soares_NhHMPu_Si Homo sapiens cDNA clone IMAGp998H131854; 24/05/06,15735 speci gp,20 7 208 NM_144617 IMAGE:754236, mRNA sequence Homo sapiens heat shock protein, alphacrystallin-related, B6 (HSPB6), mRNA 6.37 Down 6.29 Down 2.83E-05 1 .52E-04 AK093529 Homo sapiens cDNA FLJ36210 fis, clone THYMU20001 INO NM_022731 NM_018286 NM_002290 NM_015184 NM_017577 Homo sapiens nuclear ubiquitous casein kinase and cyclin-dependent kinase substrate (NUCKS), mRNA Homo sapiens hypothetical protein FLJ 10970 (FLJ1O97O), mRNA Homo sapiens laminin, alpha 4 (LAMA4), mRNA Homo sapiens phospholipase C-like 2 (PLCL2), mRNA Homo sapiens hypothetical protein DKFZp434C0328 (DKFZp434C0328), mRNA 6.27 Down 6.26 Down 6.19 Down 6.18 Down 6.17 Down 6.17 Down 6.17 Down 6.15 Down 6.14 Down 6.14 Down 9.06E-05 1 .08E-03 6.97E-04 5.91 E-04 3.60E-05 2.04E-04 3.03E-05 2.41 E-04 1.06E-04 5.02E-05 BQ350534 RCl1-HT0256-1 20400-01 9-d06 HT0256 Homo sapiens cDNA, mRNA sequence NM_004934 NM_024769 NM_197941 Homo sapiens cadherin 18, type 2 (CDH 18), mRNA Homo sapiens adipocyte-specific adhesion molecule (ASAM), mRNA Homo sapiens similar to ADAMTS-1 0 precursor (A disintegrin and metalloproteinase with thrombospondin motifs 10) (ADAM-TS (ADAM-TS1O) (L0C345667), mRNA BG1 18019 602351269171 NIHMGC_90 Homo sapiens cDNA clone IMAGE:4446065 5, mRNA sequence NM_005531 Homo sapiens interferon, gamma-inducible protein 16 (IF116), mRNA 6.13 Down 4.46E-04 24/05/06,15735 speci gp,208 209 NM_005613 NM_002166 Homo sapiens regulator of G-protein signalling 4 (RGS4), mRNA Homo sapiens inhibitor of DNA binding 2, dominant negative helix-loop-helix protein (102), mRNA 6.08 Down 6.07 Down 6.04 Down 6.03 Down 1 .04E-04 1.16 E-03 1. 15E-05 1.15 BC015720 Homo sapiens, clone IMAGE:3909165, mRNA BF508005 Ul-H-B14-apw-e-06-0-UlI.sl NCICGAPSub8 Homo sapiens cDNA clone IMAGE:3088978 3, mRNA sequence NM_007101 Homo sapiens sarcosine dehydrogenase (SARDH), mRNA 6.01 Down 5.99 Down 4.54E-03 6.94E-05 BG025371 602276295F 1 NIHMGC_85 Homo sapiens cDNA clone IMAGE:4364351 5, mRNA sequence NM_152666 Homo sapiens hypothetical protein FLJ40773 (FLJ40773), mRNA BM542398 AGENCOURT_6436663 NIHMGC_72 Homo sapiens cDNA clone IMAGE:5539574 5, mRNA sequence AK054783 Homo sapiens cDNA FLJ30221 fis, clone BRACE2001742 A1651 524 wbO6gO7.xl NCICGAPGC6 Homo sapiens cDNA clone IMAGE:2304924 3, mRNA sequence 5.99 Down 5.97 Down 5.97 Down 5.93 Down 4.55E-04 3.34E-05 2.40E-04 3.22E-04 NM_005905 Homo sapiens SMAD, mothers against DPP homolog 9 (Drosophila) (SMAD9), mRNA 5.87 Down 5.84 Down 4.76E-04 1 .07E-04 BG81 8762 602779092F2 NCICGAPBrn67 Homo sapiens cDNA clone IMAGE:4914502 5, mRNA sequence NM_002487 Homo sapiens necdin homolog (mouse) (NDN), mRNA 5.83 Down 2.72E-05 24/05/06,15735 speci gp,209 -210- NM_000167 Homo sapiens glycerol kinase transcript variant 2, mRNA 5.8 Down 5.74 Down 5.10E-03 7.92E-04 BC070147 Homo sapiens cDNA clone IMAGE:4672631, containing frame-shift errors NM_001711 NM_000407 N28431 NM_002615 Homo sapiens big lycan (BGN), mRNA Homo sapiens glycoprotein lb (platelet), beta polypeptide (GP1 BB), mRNA yx35c03.rl Soares melanocyte 2NbHM Homo sapiens cDNA clone IMAGE:263716 5 similar to SP:PIR:S32603 S32603 collagen alpha 1(VI) chain mouse;, mRNA sequence Homo sapiens serine (or cysteine) proteinase inhibitor, dlade F (alpha-2 antiplasmin, pigment epithelium derived factor), member I (SERPINFi), mRNA yn49d06.rl Scares adult brain N2b5HB55Y Homo sapiens cDNA clone IMAGE: 171755 3, mRNA sequence Home sapiens uncharacterized bone marrow protein BM039 (BM039), mRNA ym56b03.sl Soares infant brain 1iNIB Homo sapiens cDNA clone IMAGE:52294 3, mRNA sequence 5.71 Down 5.69 Down 5.69 Down 5.66 Down 4.13E-05 3.03E-05 6. 03E-04 2.02 E-03 H18367 NM_018455 H24359 5.66 Down 5.64 Down 5.61 Down 5.58 Down 5.55 Down 4.41 E-04 3.03E-04 2.57E-04 3.60E-04 9.39E-05 1 .49E-04 1 .65E-04 BU078105 im64b02.yl HR85 islet Homo sapiens cDNA clone IMAGE:6039866 5, mRNA sequence NM_022576 NM_033196 Home sapiens phosducin (PDC), transcript variant 2, mRNA Home sapiens hypothetical ZNF-like protein (L0C91120), mRNA 5.54 Down 5.54 Down BC035066 Home sapiens, clone IMAGE:5259543, mRNA 24/05/06,15735 speci gp. 2 1O -211 R 14261 yf79d05.rl Soares infant brain 1iNIB Homo sapiens cDNA clone IMAGE:28642 5, mRNA sequence BC042 140 Homo sapiens, clone IMAGE:5932306, mRNA 5.51 Down 2.36E-04 5.48 Down 5.48 Down 5.05 1.02E-05 NM_005654 NM_182746 Homo sapiens nuclear receptor subfamily 2, group F, member 1 (NR2F1), mRNA Homo sapiens MCM4 minichromosome maintenance deficient 4 cerevisiae) (MCM4), transcript variant 2, mRNA 5.48 Down 5.43 Down 9.96E-04 3.72E-04 BG573337 6025951 07171 NIHMGC_79 Homo sapiens cDNA clone IMAGE:4724521 5, mRNA sequence NM_1 94250 NM_015430 NM_006868 Homo sapiens similar to C630007C 1 7Rik protein (L0C91752), mRNA Homo sapiens regeneration associated muscle protease (DKFZP586H21 23), transcript variant 1, mRNA Homo sapiens RAB31, member RAS oncogene family (RAB3 mRNA 5.43 Down 5.43 Down 5.41 Down 5.4 Down 5.36 Down 5.34 Down 3.30E-04 3.49E-03 2.11 2.64E-03 1.89E-04 8.09E-04 B1494495 dfl 11 Ofi 1 1wi Morton Fetal Cochlea Homo sapiens cDNA clone IMAGE:2539149 3, mRNA sequence AW025556 wu97glO.xl NCICGAPKid3 Homo sapiens cDNA clone IMAGE:2528034 3, mRNA sequence A17931 82 qz36al 1 .x5 NCICGAPKidi 1 Homo sapiens cDNA clone I MAGE:2028956 3 similar to contains 1-1.t2 Li repetitive element;, mRNA sequence NM_006208 Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 1 5.34 Down 2.36E-04 24/05/06,15735 speci gp,21 I -212- (ENPP1), mRNA C02345 HUMGS0007544 Human adult (K.Okubo) 5.33 Down 3.45E-04 Homo sapiens cONA, mRNA sequence NM_032297 Homo sapiens hypothetical protein 5.32 Down 3.38E-04 DKFZp761 D1 12 (DKFZp76l D1 12), mRNA BM724062 UI-E-EO1-aiy-a-22-0-UI.rl UI-E-EO1 Homo 5.25 Down 2.96E-03 sapiens cDNA clone UI-E-EO1-aiy-a-22-0-UI mRNA sequence NM_176891 Homo sapiens interferon epsilon 1 (IFNE1), 5.22 Down 2.67E-04 mRNA BX648959 Homo sapiens mRNA; cDNA DKFZp686N2348 5.22 Down 4.12E-05 (from clone DKFZp686N2348) CA77 1688 io8lcO8.x1 HR85 islet Homo sapiens cDNA 5.22 Down 3.35E-03 clone IMAGE:6132854 3, mRNA sequence BC034315 Homo sapiens hypothetical protein L0C90529, 5.22 Down 1.90E-04 mRNA (cDNA clone IMAGE:4827425), containing frame-shift errors W88428 zh72g09.sl 5.22 Down 5.95E-04 Soares-fetal-liver -spleen_1NFLS_-Si Homo sapiens cDNA clone IMAGE:417664 3, mRNA sequence A1468014 tj84g05-xl 5.21 Down 9.55E-04 Soares NSF F8 9W OT PA P 51 Homo sapiens cDNA clone IMAGE:2 148248 3 similar to contains element TARi1 repetitive element;, mRNA sequence NM_197941 Homo sapiens similar to ADAMTS-10 precursor 5.2 Down 8.12E-04 (A disintegrin and metal lo proteinase with thrombospondin motifs 10) (ADAM-TS (ADAM-TS1O) (L0C345667), mRNA U10991 Human G2 protein mRNA, partial cds 5.19 Down 7.92E-05 24/05/06,15735 speci gp. 21 2 -213- IND Ct A1888390 wn30g10.x1 NCI_CGAP_Gas4 Homo sapiens cDNA clone IMAGE:2447010 3 similar to contains element MER8 repetitive element;, mRNA sequence 5.19 Down 2.07E-04 NM_012411 NM_030806 NM_005654 NM_153014 Homo sapiens protein tyrosine phosphatase, non-receptor type 22 (lymphoid) (PTPN22), transcript variant 2, mRNA Homo sapiens chromosome 1 open reading frame 21 (Clorf21), mRNA Homo sapiens nuclear receptor subfamily 2, group F, member 1 (NR2F1), mRNA Homo sapiens hypothetical protein FLJ30634 (FLJ30634), mRNA 5.19 Down 5.17 Down 5.17 Down 5.13 Down 5.13 Down 5.1 Down 5.1 Down 3.62E-04 1.88E-05 8.65E-05 1.32E-03 3.40E-05 1.51E-04 1.30E-04 AB020691 Homo sapiens mRNA for KIAA0884 protein, partial cds NM_020211 Homo sapiens RGM domain family, member A (RGMA), mRNA BG215747 RST35420 Athersys RAGE Library Homo sapiens cDNA, mRNA sequence NM_002317 NM_003608 NM 031305 Homo sapiens lysyl oxidase (LOX), mRNA Homo sapiens G protein-coupled receptor 65 mRNA Homo sapiens Rho GTPase activating protein 24 (ARHGAP24), mRNA 5.09 Down 5.07 Down 5.05 Down 5.03 Down 1.28E-04 7.41 E-04 1.10E-04 9.74E-05 AK124391 Homo sapiens cDNA FLJ42400 fis, clone ASTR02003581 NM_005613 NM_054027 Homo sapiens regulator of G-protein signalling 4 (RGS4), mRNA Homo sapiens ankylosis, progressive homolog (mouse) (ANKH), mRNA 5.02 Down 5 Down 7.55E-05 2.64E-05 24/05/06,15735 spcci gp, 2 13 -214- TABLE VII C: GENES THAT WERE DIFFERENTIALLY EXPRESSED AT LEAST 5 FOLD IN EPITHELIAL VERSUS AF-I CELLS INO Gene Identifier Gene Name Average fold Direction adj. pchange in value Epithelial versus AF cells AK091336 Homo sapiens cONA FLJ34017 fis, clone FCBBF2002626 NM_004098 Homo sapiens empty spiracles homolog 2 (Drosophila) (EMX2), mRNA AV702977 AV702977 ADB Homo sapiens cDNA clone ADBCVD08 5, mRNA sequence BE877764 AK075003 NM_014358 601486331F1 NIHMGC_69 Homo sapiens cDNA clone IMAGE:3888943 mRNA sequence Homo sapiens cDNA FLJ90522 fis, clone NT2RP40001O8, highly similar to Human gene for neurofilament subunit NF-L Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 9 (CLECSF9), mRNA 97.64 UP 83.49 UP 82.96 UP 60.78 UP 48.1 UP 48.04 UP 40.58 UP 38.31 UP 6.01 E-03 8.10E-03 3.74E-03 2.79E-03 1 .02E-02 1 .99E-04 1 .77E-03 1.31 E-02 AK092401 Homo sapiens cONA FLJ35082 fis, clone PLACE6005351 NM_007029 Homo sapiens stathmin-like 2 (STMN2), mRNA 24/05/06,15735 speci gp,214 -215 AW300043 NM_006158 NM_003222 xs45a09.xl NCICGAPKidIl Homo sapiens cDNA clone IMAGE:2772568 3, mRNA sequence Homo sapiens neurofilament, light polypeptide 68kDa (NEFL), mRNA Homo sapiens transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) (TFAP2C), mRNA 25.26 UP 23.08 UP 22.98 UP 22.77 UP 21.74 UP 20.08 UP 1 .35E-02 1 .76E-03 1.59E-02 7.48E-04 4.67E-03 9.54E-04 AK023647 Homo sapiens cONA FLJ 13585 fis, clone PLACE 1009150 BC044843 Homo sapiens hypothetical protein L0C339535, mRNA (cDNA clone IMAGE:5186761), partial cds BQ003501 UI-H-EI 1-azd-p-06-0-UI.sl NCICGAPEli Homo sapiens cDNA clone IMAGE:5847413 3, mRNA sequence AA075748 zm89e04.rl Stratagene ovarian cancer (#937219) Homo sapiens cDNA clone IMAGE:545118 5, mRNA sequence BF000009 7h15g04.xl NCICGAPCol6 Homo sapiens cONA clone IMAGE:3316086 3, mRNA sequence 19.94 UP 19.92 UP 7. 1 OE-03 7.67E-03 NM_004867 H85497 BM71 3465 Homo sapiens integral membrane protein 2A (ITMV2A), mRNA yv88b07.rl Soares melanocyte 2NbHM Homo sapiens cDNA clone IMAGE:249781 5, mRNA sequence Ul-E-EJO-aho-m-22-0-UI.rl UI-E-EJO Homo sapiens cDNA clone UI-E-EJOaho-m-22-0-UI 5, mRNA sequence 19.86 UP 19.75 UP 18.57 UP 2.62E-02 7.71 1 .68E-02 24/05/06,15735 speci gp,21S -216- BU569937 AGENCOURT_10399817 NIHMGC_82 Homo sapiens cDNA clone IMAGE:6618011 5, mRNA sequence NM_032782 NM_013387 Homo sapiens hepatitis A virus cellular receptor 2 (HAVCR2), mRNA Homo sapiens ubiquinol-cytochrome c reductase complex (7.2 kO) (HSPCO51), transcript variant 1, mRNA 18.3 UP 18.05 UP 17.68 UP 17.23 UP 15.46 UP 15.17 UP 1 .68E-02 2.97E-03 1 .30E-04 9.27E-03 1.08E-02 8.95E-03 BM988338 Ul-H-DHO-asd-f-1 0-0-UI si NCICGAPOHO Homo sapiens cDNA clone IMAGE:5857545 3, mRNA sequence BQ025821 Ul-1-BBlp-aye-f-10-0-Ul.sl NCICGAPP16 Homo sapiens cONA clone UI-1-BB1 p-aye-f-i 0-0-Ul 3, mRNA sequence BF51 5657 UI-H-BW1 -anu-e-05-0-Ul si NCICGAPSub7 Homo sapiens cONA clone IMAGE:.3083601 3, mRNA sequence NM_001977 NM_1 97955 NM_180991 R44402 Homo sapiens glutamyl aminopeptidase (aminopeptidase A) (EN PEP), mRNA Homo sapiens normal mucosa of esophagus specific 1 (NMES1), transcript variant 1, mRNA Homo sapiens solute carrier organic anion transporter family, member 4C 1 (SLCO4C1), mRNA yg37aOl.sl Soares infant brain iNIB Homo sapiens cONA clone IMAGE:34639 3 similar to contains repetitive element;, mRNA sequence 14.59 UP 14.33 UP 13.46 UP 13.17 UP 5.24E-05 2.54E-03 2.20E-02 1 .56E-04 24/05/06,15735 speci gp,216 -217- CF1 37545 U I-H F-BNO-ane-d-05-0-UI1 ri Homo sapiens cDNA clone IMAGE:3092384 5, mRNA sequence 12.96 UP 6.05E-03 NM_016269 NM_001680 NM_003063 NM_012204 NM_003810 NM_004591 NM_020927 NM_014751 NM_031311 NM_005382 NM_033554 Homo sapiens lymphoid enhancerbinding factor 1 (LERi), mRNA Homo sapiens FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant a, mRNA Homo sapiens sarcolipin (SLN), mRNA Homo sapiens general transcription factor IIIC, polypeptide 4, 9OkDa (GTF3C4), mRNA Homo sapiens tumor necrosis factor (ligand) superfamily, member (TNFSF1O), mRNA Homo sapiens chemokine (C-C motif) ligand 20 (CCL2O), mRNA Homo sapiens KIAA1 576 protein (KIAA1 576), mRNA Homo sapiens metastasis suppressor 1 (MTSS1), mRNA Homo sapiens carboxypeptidase, vitellogenic-like (CPVL), transcript variant 1, mRNA Homo sapiens neurofilament 3 (l5OkDa medium) (NEF3), mRNA Homo sapiens major histocompatibility complex, class 11, DP alpha 1 (HLA- DPA1I), mRNA 12.69 UP 12.65 UP 12.54 UP 12.51 U P 12.4 UP 11.84 UP 11.77 UP 11.5 UP 10.36 UP 10.12 UP 9.84 UP 9.7 UP 7.27E-03 2.38E-03 3.04E-02 3.10E-02 9.19E-05 3.08E-02 6.78E-03 6.60E-05 8.15E-03 4.45E-02 4.35E-02 3. 01 E-02 A1632692 wa33b05.xl NCICGAPKidi 1 Homo 24/0S/06,15735 speci gp.217 -218- IND NM_030923 NM_152550 AW445209 AB01 1095 NM_1 94463 NM_01 3427 NM_012105 NM_000640 NM_001977 T56535 NM_022440 sapiens clDNA clone IMAGE:2299857 3, mRNA sequence Homo sapiens hypothetical protein DKFZp566NO34 (DKFZP566NO34), m RNA Homo sapiens SH3 domain containing ring finger 2 (SH3RF2), mRNA UI-H-B313-akc-g-1 1-0-Ulsi NCICGAPSubS Homo sapiens cDNA clone IMAGE:2733908 3, mRNA sequence Homo sapiens mRNA for KIAA0523 protein, partial cds Homo sapiens ring finger protein 128 (RNF128), transcript variant 1, mRNA Homo sapiens Rho GTPase activating protein 6 (ARHGAP6), transcript variant 1, mRNA Homo sapiens beta-site APP-cleaving enzyme 2 (BACE2), transcript variant a, mRNA Homo sapiens interleukin 13 receptor, alpha 2 (IL13RA2), mRNA Homo sapiens glutamyl aminopeptidase (aminopeptidase A) (ENPEP), mRNA yb33g07.rl Stratagene fetal spleen (#937205) Homo sapiens cONA clone IMAGE:73020 5, mRNA sequence Homo sapiens mal, T-cell differentiation protein (MAL), transcript variant d, mRNA 9.51 U P 9.31 U P 9.27 UP 8.77 UP 8.75 UP 8.73 UP 8.67 UP 8.29 UP 8.16 UP 8.08 UP 8.01 UP 2.72E-02 4.41 E-02 1 .37E-03 1.82E-04 2.95 E-03 7.38E-04 1.49E-04 4.39E-02 6.01 E-03 1 .24E-04 4.29E-02 24/05/06,15735 speci p218 -219- BM711923 NM_005181 NM_030781 NM_001305 NM_000055 NM_153183 UI-E-CL1-afc-m-16-0-UI.rl UI-E-CL1 Homo sapiens cDNA clone UI-E-CL1afc-m-16-0-Ul 5, mRNA sequence Homo sapiens carbonic anhydrase 111, muscle specific (CA3), mRNA Homo sapiens collectin sub-family member 12 (COLEC12), transcript variant 11, mRNA Homo sapiens claudin 4 (CLDN4), mRNA Homo sapiens butyrylcholinesterase (BCHE), mRNA Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif (NUOTi mRNA 7.87 UP 7.69 UP 7.56 UP 7.41 U P 7.26 UP 7.23 UP 7.11 UP 8.56E-04 1 .46E-02 8.07 E-04 3.62E-04 4.51 E-03 3.53E-02 3.86E-02 B1759570 603046987F1 NIH_MGC_1 16 Homo sapiens cONA clone IMAGE:51 87285 mRNA sequence NM_015559 NM_005562 NM_013430 AA90881 5 NM_022843 NM_018076 Homo sapiens SET binding protein 1 (SETBP1), mRNA Homo sapiens laminin, gamma 2 (LAMC2), transcript variant 1, mRNA Homo sapiens gammaglutamnyltransferase 1 (GGT1), transcript variant 3, mRNA og77h08.sl NCI_CGAP_0v8 Homo sapiens cONA clone IMAGE: 1454367 3, mRNA sequence Homo sapiens protocadherin 20 (PCDH2O), mRNA Homo sapiens armadillo repeat 6.97 UP 6.95 UP 6.9 UP 6.8 UP 6.73 UP 6.71 U P 3.67E-02 2.06E-04 3.86E-02 3.10E-02 5.39E-03 7.53E-04 24/05106,15735 speci gp, 2 1 9 220 containing 4 (ARMC4), mRNA NM_005822 NM_006393 CA391 258 Homo sapiens Down syndrome critical region gene 1 -like 1 (OSCRi mRNA Homo sapiens nebulette (NEBL), transcript variant 1, mRNA csl3alO.xl Human Retinal pigment epithelium/choroid cONA (Unnormalized, unamplified): cs Homo sapiens cDNA clone csl 3alO0 3, mRNA sequence AK026966 Homo sapiens cDNA: FLJ23313 fis, clone HEP1 1919 NM_020661 NM_004840 BC021684 NM_032551 NM_024726 NM_001657 NM_006033 NM_002089 AK074097 Homo sapiens activation-induced cytidine deaminase (AICDA), mRNA Homo sapiens Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 (ARHGEF6), mRNA Homo sapiens, clone IMAGE:3827252, mRNA Homo sapiens G protein-coupled receptor 54 (GPR54), mRNA Homo sapiens IQ motif containing with AAA domain (IQCA), mRNA Homo sapiens amphiregulin (schwa nnoma-derived growth factor) (AREG), mRNA Homo sapiens lipase, endothelial (LIPG), mRNA Homo sapiens chemokine (C-X-C motif) ligand 2 (CXCL2), mRNA Homo sapiens mRNA for FLJO0168 6.67 UP 6.66 UP 6.56 UP 6.31 U P 6.12 UP 6.09 UP 6.03 UP 5.96 UP 5.94 UP 5.91 U P 5.9 UP 5.88 UP 5.87 UP 2.38E-02 4.24E-02 9.19E-05 1 .30E-04 3.01 E-02 1.19E-03 4.71 E-03 4.33E-02 1 .84E-04 1 .05E-03 1 .76E-04 1.13E-04 1.17E-03 24/05106.15735 speci gp,220 -221 protein BF509573 Ul-H-B14-apf-b-1 1 -0-UI si N~lCGAPSub8 Homo sapiens cONA clone IMAGE:3086949 3, mRNA 5.78 UP 1.40E-04 sequence H23441 NM_031426 NM_013410 NM_003236 NM_152369 NM_153229 NM_000216 H89526 AL832916 ym52fll.sl Soares infant brain INIB Homo sapiens cDNA clone IMAGE:51888 3, mRNA sequence Homo sapiens chromosome 9 open reading frame 58 (C9orf58), transcript variant 1, mRNA Homo sapiens adenylate kinase 3 (AK3), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA Homo sapiens transforming growth factor, alpha (TGFA), mRNA Homo sapiens hypothetical protein MGC45474 (MGC45474), mRNA Homo sapiens hypothetical protein FLJ33318 (FLJ33318), mRNA Homo sapiens Kallmann syndrome 1 sequence (KAOl), mRNA yw28b04.rl Morton Fetal Cochlea Homo sapiens cDNA clone IMAGE:253519 mRNA sequence Homo sapiens mRNA; cONA DKFZp76210915 (from clone DKFZp762IO91 Homo sapiens retinol binding protein 1, cellular (RBP1), mRNA Ul-H-FEO-bbp-d-2 1-0-UlI.s1 5.77 UP 6. 87E-04 5.63 UP 5.54 UP 5.51 U P 5.46 UP 5.4 UP 5.23 UP 5.15 UP 5.12 UP 3.32E-05 1 .14E-04 3.09E-02 1 .02E-04 1 .92E-03 1.13 E-04 9.54E-05 6.74E-03 NM_002899 CA417015 5.07 UP 5.07 UP 1. 11 E-03 1.77E-03 24/05/06,15735 speci gp.22 I 222 AW263542 T47612 NM_002402 NM_001884 NM_006439 NM_001202 NM_017671 NCICGAPFEO Homo sapiens cDNA clone UI-H-FEO-bbp-d-21-0-UI 3, mRNA sequence xn8OfOl xl SoaresNFLTGBCSi Homo sapiens cDNA clone IMAGE:2700793 3, mRNA sequence ybl 5hO3.sl Stratagene placenta (#937225) Homo sapiens cDNA clone IMAGE:71285 3, mRNA sequence Homo sapiens mesoderm specific transcript homolog (mouse) (MEST), transcript variant 1, mRNA Homo sapiens hyaluronan and proteoglycan link protein 1 (HAPILNII), mRNA Homo sapiens mab-21 -like 2 (C. elegans) (MAB21L2), mRNA Homo sapiens bone morphogenetic protein 4 (BMP4), transcript variant 1, mRNA Homo sapiens chromosome 20 open reading frame 42 (C20rf42), mRNA 5.07 UP 5.02 UP 9.70E-03 7.57E-03 83.38 Down 71.21 Down 70.58 Down 50.48 Down 50.28 Down 1.30E-04 5.97E-05 7.65E-05 3.32E-05 4.04E-05 AK1 24396 Homo sapiens cDNA FLJ42405 fis, clone ASTR03000474 45.55 Down 6.98E-05 NM_015170 Homo sapiens sulfatase 1 (SULFi), mRNA 38.04 Down 7.58E-05 BC037316 Homo sapiens, clone IMAGE:5259432, mRNA NM_001562 Homo sapiens interleukin 18 (interferongamma-inducing factor) (11l18), mRNA 34.94 Down 34.48 Down 28.72 Down 7.08E-05 7.58E-05 4.44E-05 A1469032 ti7OaOl xl NCICGAPKidli Homo 24/05/06, 15735 speci gp, 222 223 NM_016307 NM_022475 NM_006072 NM_007361 NM_006228 sapiens cDNA clone IMAGE:2137320 3, mRNA sequence Homo sapiens paired related homeobox 2 (PRRX2), mRNA Homo sapiens hedgehog interacting protein (HHIP), mRNA Homo sapiens chemokine (C-C motif) ligand 26 (CC L26), mRNA Homo sapiens nidogen 2 (osteonidogen) (NID2), mRNA Homo sapiens prepronociceptin (PNOC), mRNA zb8lellisi Soares-senescent-fibroblastsNbHSF Homo sapiens cDNA clone IMAGE:310028 3, mRNA sequence Homo sapiens hypothetical protein FLJ10847 (FLJ10847), mRNA yy6OdO4.sl Soares multiple-sclerosis_2NbHMSP Homo sapiens cDNA clone IMAGE:277927 3 similar to contains L1.b3 Li repetitive element;, mRNA sequence 28.57 Down 27 Down 25.57 Down 22.81 Down 21.34 Down 20.92 Down 3.32E-05 7.14E-05 5.83E-05 5.24E-05 4.20E-04 1.24E-04 N95448 NM_018242 20.83 Down 19.2 Down 6.60E-05 5.24E-05 N63415 BQ00 1571 U I-H-DH 1-awr-i- 18-0-U1. s 1 NCICGAPDH1 Homo sapiens cDNA clone IMAGE:5893337 3, mRNA sequence 18.75 Down 6.98E-05 NM_022454 BE788763 Homo sapiens SRY (sex determining region Y)-box 17 (SOX17), mRNA 601475864F1 NIHMGC_68 Homo sapiens cDNA clone IMAGE:3879014 18.21 Down 17.84 Down 5.83E-05 1.13E-04 24/05/06,15735 speci gp, 223 224 mRNA sequence BU6331 63 UI-H-FL1 -bgt-n-07-0-UI.sl NClCGAPELi Homo sapiens cDNA clone UI-H-FL1 -bgt-n-07-0-UI 3, mRNA sequence A1289329 qw28c09.xl NCICGAPUt4 Homo sapiens cDNA clone IMAGE: 1992400 3 similar to contains L1.b2 Li repetitive element;, mRNA sequence AF318382 Homo sapiens pp9974 mRNA, complete 17.41 Down 17.1 Down 7.14E-05 6.98E-05 16.45 Down 1 .38E-04 NM_022350 Homo sapiens leukocyte-derived arginine aminopeptidase (LRAP), mRNA 15.8 Down 14.77 Down 1.10 E-04 1.94E-04 B1561641 603256058F1 NIHMGC_97 Homo sapiens cDNA clone IMAGE:5298374 mRNA sequence NM_006350 NM_016588 CA4 37861 NM_020873 NM_003385 Homo sapiens follistatin (EST), transcript variant FST317, mRNA Homo sapiens neuritin 1 (NRN1), mRNA UI-H-DHO-aur-k-1 2-0-UI .sl NCICGAPDHO Homo sapiens cDNA clone UI-H-DHO-aur-k-12-0-UI 3, mRNA sequence Homo sapiens leucine rich repeat neuronal 1 (LRRN1), mRNA Homo sapiens visinin-like 1 (VSNL1), mRNA 14.55 Down 14.52 Down 14.45 Down 13.74 Down 13.06 Down 7.14E-05 6.98E-05 1.21 E-04 6.60E-05 7.75E-05 A1640484 wa27fOl.xl NClCGAPKidli Homo sapiens cDNA clone IMAGE:2299321 3, mRNA sequence AK127309 Homo sapiens cDNA FLJ45377 fis, clone 11.92 Down 11.87 Down 5.48E-04 2.35E-04 24/05/06,15735 speci gp, 224 -225- BRHI P3019956 M60502 NM_006475 NM_207482 NM_000519 Human profilaggrin mRNA, 3 end Homo sapiens periostin, osteoblast specific factor (POSTN), mRNA Homo sapiens FLJ44048 protein (FLJ44048), mRNA Homo sapiens hemoglobin, delta (HBD), mRNA 11.74 Down 11.74 Down 11.63 Down 11.61 Down 7.58E-05 1.19E-04 1 .45E-04 3.27E-04 BU567804 AGENCOURT_10398872 NIHMGC_82 Homo sapiens cDNA clone iMAGE:66 14502 5, mRNA sequence AJ31 8805 AJ318805 Homo sapiens adipose tissue Homo sapiens cDNA clone 2040, mRNA sequence AW451831 UI-H-B313-alk-e-12-0-UI1.sl Homo sapiens cONA clone IMAGE:2737246 3, mRNA sequence 11.59 Down 11.59 Down 5.24E-05 1 .76E-04 11.57 Down 1.46E-04 R99527 NM_031894 NM_007072 NM_005654 NM_004574 NM_005141 yq79bl 1.sl Soares fetal liver spleen I NELS Homo sapiens cDNA clone IMAGE:201981 3, mRNA sequence Homo sapiens ferritin, heavy polypeptide-like 17 (FTHL1 mRNA Homo sapiens HERV-H LTR-associating 2 (HHLA2), mRNA Homo sapiens nuclear receptor subfamily 2, group F, member 1 (NR2F71), mRNA Homo sapiens peanut-like 2 (Drosophila) (PNUTL2), transcript variant 1, mRNA Homo sapiens fibrinogen, B beta 11.16 Down 11.12 Down 10.94 Down 10.91 Down 10.46 Down 10.37 Down 1. 13E-04 4.85E-04 1 .36E-04 3.32E-05 3.48E-04 4.85E-04 24105/06,15735 speci gp. 22 226 polypeptide (FGB), mRNA A1905628 CM-BT094-050299-147 BT094 Homo sapiens cDNA, mRNA sequence BG622707 602647476F1 NIHMGC_79 Homo sapiens cDNA clone IMAGE:4768963 mRNA sequence W76003 zd58g07.rl Soares-fetal-heartNbHH19W Homo sapiens cDNA clone IMAGE:344892 mRNA sequence 10.36 Down 10.35 Down 10.32 Down 10.23 Down 9.84 Down 9.76 Down 9.71 Down 1 .49E-04 1 .73E-04 1 .58E-04 1.80E-04 7.54E-05 8.07E-04 3.65E-04 H 15096 ym29ell1.r1 Soares infant brain 1iNIB Homo sapiens cDNA clone IMAGE:49250 5, mRNA sequence A1493349 tg7OfO4.xl SoaresNhHMPuSi Homo sapiens cDNA clone IMAGE:21 14143 3, mnRNA sequence AK093762 Homo sapiens cDNA FLJ36443 fis, clone THYMU201 2891 BU570253 AGENCOURT_10401698 NIHMGC_82 Homo sapiens cDNA clone IMAGE:6618451 5, mRNA sequence NM_005855 NM_003328 NM_003004 NM_005596 BC039450 Homo sapiens receptor (calciton in) activity modifying protein 1 (RAMPi), mRNA Homo sapiens TXK tyrosine kinase (TXK), mRNA Homo sapiens secreted and transmembrane 1 (SEOT~IV), mRNA Homo sapiens nuclear factor I/B (N FIB), mRNA Homo sapiens, clone IMAGE:53111619, 9.33 Down 9.29 Down 9.23 Down 9.23 Down 9.07 Down 7.08E-05 1. 19E-04 1 .76E-04 4.97E-05 1. 13E-04 24/05/06.15735S spcci gp, 226 227 mRNA NM_005613 NM_003973 BM675270 NM_001311 NM_000087 AW021686 NM_002031 NM_005279 NM_004460 Homo sapiens regulator of G-protein signalling 4 (RGS4), mRNA Homo sapiens ribosomal protein L14 (RPL14), mRNA UI-E-EJO-ahr-j-07-0-UI.sl U l-E-EJO Homo sapiens cDNA clone UI-E-EJOahr-j-07-0-UI 3, mRNA sequence Homo sapiens cysteine-rich protein 1 (intestinal) (CRIPil), mRNA Homo sapiens cyclic nucleotide gated channel alpha 1 (CNGA1), mRNA df26hll1.yl Morton Fetal Cochlea Homo sapiens cDNA clone IMAGE:2484717 mRNA sequence Homo sapiens fyn-related kinase (FIRK), mRNA Homo sapiens G protein-coupled receptor 1 (GPRI), mRNA Homo sapiens fibroblast activation protein, alpha (FAIP), mRNA 8.99 Down 8.98 Down 8.96 Down 8.91 Down 8.76 Down 8.74 Down 8.67 Down 8.51 Down 8.51 Down 8.46 Down 7.65E-05 6.60E-05 1.34E-03 7.14E-05 1 .33E-03 4.04E-05 1. 14E-04 4.16E-04 7.71 E-04 1 .73E-04 BE904671 601498784171 NIHMGC_70 Homo sapiens cDNA clone IMAGE:390071 7 mRNA sequence NM_000612 Homo sapiens insulin-like growth factor 2 (somatomedin A) (IGF2), mRNA 8.27 Down 1. 19E-04 1. 13E-04 ALl37488 Homo sapiens mRNA; cDNA DKFZp434N2O3O (from clone DKFZp434N2O3O) 8.23 Down NM_006288 Homo sapiens Thy-i cell surface antigen (THYl), mRNA 8.18 Down 1 .43E-03 24/05/06,15735 speci gp,227 -228- NM_002837 NM_030899 NM_002193 BX537698 Homo sapiens protein tyrosine phosphatase, receptor type, B (PTPRB), mRNA Homo sapiens zinc finger protein 323 (ZNF323), mRNA Homo sapiens inhibin, beta B (activin AB beta polypeptide) (INHBB), mRNA Homo sapiens mRNA; cONA DKFZp686F09166 (from clone DKFZp686FO91 66) INO BC033567 Homo sapiens, clone IMAGE:4822266, mRNA NM_052997 NM_178550 NM_178033 NM_002924 NM_012242 AA740671 NM_005712 BC040293 Homo sapiens ankyrin repeat domain (AN KRD3OA), mRNA Homo sapiens hypothetical protein MGC48998 (MGC48998), mRNA Homo sapiens cytochrome P450, family 4, subfamily X, polypeptide 1 (CYP4X1), mRNA Homo sapiens regulator of G-protein signalling 7 (RGS7), mRNA Homo sapiens dickkopf homolog 1 (Xenopus laevis) (DKK1), mRNA obO hO5.sl NCI CGAP Kid3 Homo sapiens cDNA clone IMAGE: 1322457 3, mRNA sequence Homo sapiens HERV-H LTR-associating 1 (HHLA1), mRNA Homo sapiens, clone IMAGE:4820330, mRNA 8.15 Down 8.08 Down 8.07 Down 8.06 Down 8.04 Down 7.97 Down 7.82 Down 7.81 Down 7.8 Down 7.77 Down 7.74 Down 7.67 Down 7.65 Down 1. 19E-03 9. 54E-05 1 .90E-04 1 .34E-03 1.88E-04 1 .42E-03 5.76E-04 8.OOE-04 5.38E-04 1.24E-04 2.22E-03 1 .80E-04 3.10E-04 24105/06,15735 speci gp,228 -229- NM_000089 NM_005654 BE4651 34 NM_002522 AK093529 NM_003662 NM_001769 Homo sapiens collagen, type 1, alpha 2 (COL1A2), mRNA Homo sapiens nuclear receptor subfamily 2, group F, member 1 (NR2F1), mRNA hv7SellI.xl NCI_CGAP_Lu24 Homo sapiens cDNA clone IMAGE:3179276 3, mRNA sequence Homo sapiens neuronal pentraxin I (NPTX1), mRNA Homo sapiens cDNA FLJ3621 0 fis, clone THYMU20001 Homo sapiens pirin (iron-binding nuclear protein) (PIR), mRNA Homo sapiens CD9 antigen (p24) (CD9), mRNA 7.64 Down 7.63 Down 7.53 Down 7.49 Down 7.47 Down 7.29 Down 7.23 Down 7.21 Down 1.17 E-03 2.73 E-04 1 .28E-03 6.53E-04 1.18 E-04 6.96E-05 1 .80E-04 1 .24E-04 AL359567 Homo sapiens mRNA; cDNA DKFZp547DO23 (from clone DKFZp547D023) BX64731 3 NM_003979 Homo sapiens mRNA; cDNA DKFZp686N 1593 (from clone DKFZp686N1 593) Homo sapiens G protein-coupled receptor, family C, group 5, member A mRNA 7.19 Down 7.18 Down 7.04 Down 7.03 Down 1.19E-04 1.63E-03 3.01 E-04 8.55E-04 A1365141 qx96e07.xl NOI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2010372 3, mRNA sequence CA948963 iq3OfO5.yl HR85 islet Homo sapiens cDNA clone IMAGE: 5, mRNA sequence NM_002977 Homo sapiens sodium channel, voltage- 6.99 Down 5.83E-05 24/05/06.15735 speci gp.229 -230- BC0331 24 NM_003385 NM_013262 NM_001843 NM_006727 NM_016192 NM_031847 CB1 15754 NM_025074 NM_016206 gated, type IX, alpha (SCN9A), mRNA Homo sapiens, clone IMAGE:2960615, mRNA Homo sapiens visinin-like 1 (VSNL1), mRNA Homo sapiens myosin regulatory light chain interacting protein (MYLIP), mRNA Homo sapiens contactin 1 (CNTN1), transcript variant 1, mRNA Homo sapiens cadherin 10, type 2 (T2cadherin) (CDH1O), mRNA Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 2 (TM EFF2), mRNA Homo sapiens microtubule-associated protein 2 (MAP2), transcript variant 4, mRNA K-EST0159876 L8SCKO Homo sapiens cONA clone L8SCKO-8-H08 5, mRNA sequence Homo sapiens Fraser syndrome 1 (FRAS transcript variant 1, mRNA Homo sapiens colon carcinoma related protein (FLJ38507), mRNA 6.86 Down 6.73 Down 6.65 Down 6.64 Down 6.59 Down 6.58 Down 6.57 Down 6.55 Down 6.52 Down 6.45 Down 6.35 Down 6.60E-05 1.26E-04 1 .66E-04 3. 37E-03 1.91 E-03 9.19E-05 1. 13E-03 8.55E-04 4.97E-05 5.30E-04 3.01 E-04 BC015159 Homo sapiens cDNA clone IMAGE:3885734, partial cds NM_005613 Homo sapiens regulator of G-protein signalling 4 (RGS4), mRNA 6.33 Down 6.28 Down 1 .62E-03 7.53E-04 W88428 zh72g09.sl Soares-fetal-liver-spleen_1 NFLSSi Homo sapiens cDNA clone 24/05/06.15735 speci gp,230 -231 NM_058187 NM_020836 BX1 07838 NM_004496 NM_021637 NM_002521 IMAGE:417664 3, mRNA sequence Homo sapiens chromosome 21 open reading frame 63 (C2lorf63), mRNA Homo sapiens brain-enriched guanylate kinase-associated protein (KIAA1 446), mRNA BX107838 NCI_CGAP_Lu5 Homo sapiens cDNA clone IMAGp998A1 53853 IMAGE: 1521686, mRNA sequence Homo sapiens forkhead box All (FOXAl), mRNA Homo sapiens transmembrane protein (TM EM35), mRNA Homo sapiens natriuretic peptide precursor B (NPPB), mRNA 6.16 Down 6.15 Down 6.14 Down 6.13 Down 6.1 Down 6.1 Down 6.08 Down 5.39E-03 3.75E-03 1 .77E-03 1.94E-04 2.12E-03 4.86E-04 7.63E-05 BF431041 nab3lgO2.xl Soares_NSF_F8_9W_OT_PA_P_Si Homo sapiens cDNA clone IMAGE:3267627 3, mRNA sequence NM_003713 Homo sapiens phosphatidic acid phosphatase type 2B (PPAP2B3), transcript variant 1, mRNA AV728294 AV728294 HTC Homo sapiens cDNA clone HTCBIE09 5, mRNA sequence NM_002148 NM_176891 NM_002317 NM_016179 Homo sapiens homeo box D10 (HOXD1O), mRNA Homo sapiens interferon epsilon 1 (IFNE1l), mRNA Homo sapiens lysyl oxidase (LOX), mRNA Homo sapiens transient receptor 6.05 Down 6.03 Down 6.01 Down 6 Down 5.99 Down 5.99 Down 6.44E-04 7.71 7.14E-05 7.48E-04 3.17E-04 9.19E-05 24/0S/06,15735 speci gp, 2 3 1 232 AWl 34473 NM_005130 AW5121 11 NM_020349 NM_001083 H94320 NM_032461 BM994473 BE540906 NM_033255 potential cation channel, subfamily C, member 4 (TRPC4), mRNA UI-H-BI1-abv-a-1 1-0-Ulsi NCICGAPSub3 Homo sapiens cDNA clone IMAGE:2712885 3, mRNA sequence Homo sapiens fibroblast growth factor binding protein 1 (FGFBP1), mRNA xx7OeO5.xl NOICGAPLyml2 Homo sapiens cONA clone IMAGE:2849024 3 similar to contains Alu repetitive element;, mRNA sequence Homo sapiens ankyrin repeat domain 2 (stretch responsive muscle) (ANKRD2), mRNA Homo sapiens phosphodiesterase 5A, cGMP-specific (POE5A), transcript variant 1, mRNA yvl 8blO.sl Scares fetal liver spleen 1iNEFLS Homo sapiens cDNA clone IMAGE:243067 3, mRNA sequence Homo sapiens SPANX family, member 131 (SPANXIB1), mRNA UI-H-DHO-aul--1 8-0-UI.sl NCICGAPOHO Home sapiens cDNA clone IMAGE:5871137 3, mRNA sequence 6010630271 NIH-MGC-10 Homo sapiens cDNA clone IMAGE:3449455 mRNA sequence Homo sapiens epithelial stromal interaction 1 (breast) (EPST11), mRNA 5.98 Down 5.95 Down 5.93 Down 5.91 Down 5.88 Down 5.83 Down 5.8 Down 5.79 Down 5.79 Down 5.75 Down 7.04E-05 5.89E-04 4.97E-05 1. 18E-04 3.74E-03 3.18E-02 1.08E-03 1.10E-04 4.45E-05 8.55E-04 24/05/06,15735 speci gp,232 -233- INO BU61 6268 UI-H-DFO-bex-n-1 2-0-UI.sl NCICGAPOFO Homo sapiens cDNA clone UI-H-DF0-.bex-n-1 2-0-UI 3, mRNA sequence 5.73 Down 6.74E-04 7.32E-04 BX1 12170 BX1 12170 Soares-fetalheartNbHH19W Homo sapiens cDNA clone IMAGp998007742; IMAGE:327390, mRNA sequence BC01 5108 Homo sapiens, Similar to otoconin 90, clone IMAGE:4044247, mRNA 5.73 Down NM_000576 AW470868 Homo sapiens interleukin 1, beta (ILI B), mRNA ha34h03.xl NCI_CGAP_Kid 12 Homo sapiens cDNA clone IMAGE:2875637 3, mRNA sequence 5.72 Down 5.7 Down 5.7 Down 5.7 Down 2.40E-03 2.97 E-03 2.31 E-03 1. 11 E-03 AK093069 Homo sapiens cDNA FLJ35750 fis, clone TEST12004539, weakly similar to Homo sapiens adlican mRNA NM_032330 U51 694 NM_004335 Homo sapiens calpain, small subunit 2 (CAPNS2), mRNA HSU51694 Human normal gingiva Homo sapiens cDNA, mRNA sequence Homo sapiens bone marrow stromal cell antigen 2 (BST2), mRNA 5.68 Down 5.62 Down 5.61 Down 5.59 Down 5.59 Down 4.44E-03 1 .02E-04 2.84E-03 7.53E-04 8.07E-04 BF431460 7o14b05.xl NCI_CGAP_Kidli Homo sapiens cDNA clone IMAGE:3573849 3, mRNA sequence BC046362 Homo sapiens voltage-dependent calcium channel gamma subunit-like protein, mRNA (cDNA clone MGC:50757 IMAGE:5221396), complete cdls 24/05/06,15735 speci gp, 233 -234- NM_000961 Homo sapiens prostaglandin 12 (prostacyclin) synthase (PTGIS), mRNA AK022877 Homo sapiens cDNA FLJ12815 fis, clone NT2RP2002546 5.57 Down 5.56 Down 5.51 Down 5.49 Down 1.01 E-03 4.04E-05 3.04E-04 1 .40E-03 NM_002277 Homo sapiens keratin, hair, acidic, 1 (KIRTHA1I), mRNA AK092245 Homo sapiens cDNA FLJ34926 fis, clone NT2RP700331 9, highly similar to Mus musculus neuralin mRNA NM_002427 BM991 890 NM_002575 NM_000782 NM_016276 Homo sapiens matrix metalIloprotei nase 13 (collagenase 3) (MMP1 mRNA UI-H-DF1 -auk-h-02-0-UI.sl NCICGAPDF1 Homo sapiens cDNA clone IMAGE:5870641 3, mRNA sequence Homo sapiens serine (or cysteine) proteinase inhibitor, dlade B (ovalbumin), member 2 (SERPINB2), mRNA Homo sapiens cytochrome P450, family 24, subfamily A, polypeptide 1 (CYP24A1I), nuclear gene encoding mitochondrial protein, mRNA Homo sapiens serum/glucocorticoid regulated kinase 2 (SGK2), transcript variant 2, mRNA 5.47 Down 5.39 Down 5.39 Down 5.36 Down 5.34 Down 5.32 Down 5.31 Down 4.45E-04 7. 53E-04 9.60E-03 1. 31 E-02 6.73E-04 1 .36E-04 6.OOE-03 AK024689 Homo sapiens cDNA: FLJ21036 fis, clone CAE09578 N78829 zbl 7a05.sl Soares-fetal-lungNbHL19W Homo sapiens cDNA clone IMAGE:302288 3, mRNA sequence 24/05106,15735 speci gp,234 235 AL080103 Homo sapiens mRNA; cDNA DKFZp564N2216 (from clone DKFZp564N221 6) BC035400 Homo sapiens, clone IMAGE:4822830, mRNA AK056725 Homo sapiens cDNA FLJ32 163 fis, clone PLACE6000371 AK025595 Homo sapiens cDNA: FLJ21942 fis, clone HEP04527 5.26 Down 5.17 Down 5.13 Down 5.12 Down 1.61 E-04 1.13E-02 3.72E-04 1 .56E-02 NM_015236 NM_012411 Homo sapiens latrophilin 3 (LPHN3), mRNA Homo sapiens protein tyrosine phosphatase, non-receptor type 22 (lymphoid) (PTPN22), transcript variant 2, mRNA 5.11 Down 5.1 Down 5.08 Down 3.14E-04 2.78E-03 2.24E-03 A1190760 qd61c05.xl Soares-testisNHT Homo sapiens cDNA clone IMAGE:1733960 3, mRNA sequence NM_139241 NM_033066 BG573337 AA158235 Homo sapiens FYVE, RhoGEF and PH domain containing 4 (FGD4), mRNA Homo sapiens membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) (MPP4), mRNA 6025951 07F1 NIHMGC_79 Homo sapiens cDNA clone IMAGE:4724521 mRNA sequence zo76b02.sl Stratagene pancreas (#937208) Homo sapiens cDNA clone IMAGE:592779 3, mRNA sequence 5.04 Down 5.04 Down 5.03 Down 5.01 Down 5.01 Down 6.92E-03 7.11 E-03 5.60E-03 7.1 OE-03 1 .69E-02 BX092004 BX092004 NCICGAPKidi 1 Homo sapiens cDNA clone IMAGp998B195924 24/05/06,1573 5 speci gp, 23 -236- IMAGE:2385330, mRNA sequence Homo sapiens cDNA FLJ2531 1 fis, clone SYN01 066 AK058040 5 Down 1 .76E-03 TABLE VII D: GENES THAT WERE DIFFERENTIALLY EXPRESSED AT LEAST 5 FOLD IN AF-I VERSUS AF-I AT TERM CELLS Gene Identifier Gene Name Average fold change in AF cells isolated from 2nd trimester amniotic fluid versus AF cells islolated at term Direction adj. pvalue Homo sapiens prepronociceptin (PNOC), NM_0062 mRNA 28 Homo sapiens mab-21-like 2 elegans) NM_0064 (MAB321L-2), mRNA 39 Homo sapiens cDNA FLJ34926 fis, clone AK092245 NT2RP7003319, highly similar to Mus musculus neuralin mRNA 64.08 UP 47.74 UP 44.83 UP 1 .14E-04 1 .03E-04 8.97E-05 Homo sapiens cONA FLJ31869 fis, clone 35.22 UP 5.97E-05 24/05/06,15735 speci gp.236 -237- AK056431 NT2RP7002151 Homo sapiens sulfatase 1 (SULFi), mRNA NM_0151 30.43 UP 1 .53E-04 NM_0018 84 NM_0024 87 Homo sapiens hyaluronan and proteoglycan link protein 1 (HAPLN mRNA Homo sapiens necdin homolog (mouse) (NON), mRNA 27.82 UP 25.93 UP 3.92E-05 2.07E-04 Homo sapiens, clone IMAGE:5259432, mRNA BC037316 25.16 UP 5.97E-05 Homo sapiens leucine rich repeat neuronal 1 (LRRN1), mRNA NM_0208 73 24.74 UP 23.95 UP 6.46E-05 6.63E-05 H89053 yw24c06.rl Morton Fetal Cochlea Homo sapiens cONA clone IMAGE:253162 5, mRNA sequence Homo sapiens homeo box D010 (HOXDl 0), mRNA 20.48 UP 8.97E-05 NM_0021 Homo sapiens dickkopf homolog 2 (Xenopus laevis) (DKK2), mRNA NM_0144 21 20.41 UP 20.08 UP 6.46E-05 5.97E-05 Homo sapiens TP53TG3 protein (TP53TG3), NM_0162 mRNA 12 Homo sapiens serine-arginine repressor protein NM_0807 (35 kDa) (SRrp35), mRNA 43 Homo sapiens glycine dehydrogenase NM_0001 (decarboxylating; glycine decarboxylase, 19.58 UP 6.46E-05 18.22 UP 9.61 24105/06,15735 speci gp.237 -238glycine cleavage system protein P) (GLDC), mRNA Homo sapiens mRNA; cDNA DKFZp686N1593 17.47 UP 6.46E-05 BX647313 (from clone DKFZp686N1593) Homo sapiens nidogen 2 (osteonidogen) 17.41 UP 9.75E-05 NM_0073 (NID2), mRNA 61 Homo sapiens HERV-H LTIR-associating 2 16.06 UP 9.61 NM_0070 (HHLA2), mRNA 72 Homo sapiens carnitine palmitoyltransferase 1C 15.65 UP 2.26E-04 NM_1523 (CPT1C), mRNA 59 Homo sapiens retinol binding protein 1, cellular 15.47 UP 1.40E-04 NM_0028 (RBP1), mRNA 99 Homo sapiens interferon, gamma-inducible 15.18 UP 1.67E-04 NM_0055 protein 16 (1F116), mRNA 31 Homo sapiens homeo box DII (HOXD1 15.05 UP 1. 11 E-04 NM_0211 mRNA 92 Homo sapiens paired related homeobox 2 14.33 UP 5.97E-05 NM_0163 (PRRX2), mRNA 07 nxl 3bO2.sl NOICGAPGC3 Homo sapiens 14.27 UP 1.64E-05 AA738254 cDNA clone IMAGE:1255947 3, mRNA sequence 601475864F1 NIHMGC_68 Homo sapiens 14.17 UP 3.92E-05 BE788763 cONA clone IMAGE:3879014 5, mRNA sequence Homo sapiens cytoplasmic polyadenylation 14.01 UP 1.40E-04 24/05/06,15735 speci gp.238 -239- NM_0306 element binding protein 4 (CPEB4), mRNA 27 BX1 13319 N~lCGAPGas4 Homo sapiens 13.62 UP 5.09E-05 BX1 13319 cONA clone I MAGp998G205398; IMAGE:2184619, mRNA sequence Homo sapiens Fraser syndrome 1 (FRASi), 13.55 UP 5.09E-05 NM_0250 transcript variant 1, mRNA 74 Homo sapiens cysteine-rich protein 1 13 UP 8.97E-05 NM_0013 (intestinal) (CRIPI), mRNA IND Homo sapiens hypothetical protein BC008217 12.64 UP 2.09E-04 NM_1383 (L0C92906), mRNA 94 7ol11d09.xl NCICGAPKidl11 Homo sapiens 12.04 UP 1.10E-04 BF431313 cONA clone IMAGE:3573928 3, mRNA sequence Homo sapiens decorin (DCN), transcript variant 11.74 UP 2.01 E-04 NM_1335 B, mRNA 04 AGENCOURT-10398872 NIH-MGC-82 Homo 11.67 UP 5.09E-05 BU567804 sapiens cONA clone IMAGE:6614502 5, mRNA sequence UI-H-DHO-aur-k-12-0-UI.sl NCICGAPOHO 10.89 UP 4.99E-05 CA437861 Homo sapiens cDNA clone UI-H-DHO-aur-k-12- 0-UI 3, mRNA sequence nab3lgO2.xl 10.78 UP 3.92E-05 BF431041 SoaresNSFF8_9WOTPAPSI Homo sapiens cONA clone IMAGE:3267627 3, mRNA sequence Homo sapiens neuropilin (NRP) and tolloid 10.4 UP 8.97E-05 NM_1 389 (TLL)-like 1 (NET0l), transcript variant 3, 24/05/06,15735 speci gp.239 240 66 mRNA UI-H-FL1-bgt-n-07-0-UI.sl NCICGAPFLi 10.32 UP 6.63E-05 BU633163 Homo sapiens cONA clone Ul-H-FL1-bgt-n-07- 0-UI 3, mRNA sequence M60502 Human profilaggrin mRNA, 3 end 10.26 UP 1.40E-04 Homo sapiens armadillo repeat containing, X- 9.9 UP 1 .62E-04 NM_1779 linked 2 (ARMCX2), mRNA 49 602647476F1 NIHMGC_79 Homo sapiens 9.78 UP 1.24E-04 BG62270 cDNA clone IMAGE:4768963 5, mRNA 7 sequence Homo sapiens mRNA; cDNA DKFZp434A2O29 9.75 UP 1.34E-04 AL834140 (from clone DKFZp434A2029) Homo sapiens phospholipid scramblase 4 9.71 U P 8.97E-05 NM_0203 (PLSCR4), mRNA 53 A1905628 CM-BT094-050299-147 BT094 Homo sapiens 9.65 UP 1.03E-04 cONA, mRNA sequence Homo sapiens HERV-H LTR-associating 1 9.52 UP 1.10E-04 NM_0057 (HHLA1), mRNA 12 Homo sapiens TXK tyrosine kinase (TXK), 9.49 UP 2.35E-04 NM_0033 mRNA 28 Homo sapiens cDNA FLJ38254 fis, clone 9.39 UP 3.92E-05 AK095573 FCBBF3000847 Homo sapiens ribosomal protein L14 (RPL14), 9.37 UP 9.74E-05 NM_0039 mRNA 73 Homo sapiens mRNA; cDNA DKFZp434C1915 9.32 UP 1.48E-03 AL1 37698 (from clone DKFZp434C1 91 partial cds 24/05/06,15735 speci gp, 240 -241 Homo sapiens F-box protein 9 (FBXO9), 9.29 UP 1.40E-04 NM_0334 transcript variant 2, mRNA Homo sapiens neuritin 1 (NRN1), mRNA 9.16 UP 4.09E-04 NM_0165 88 Homo sapiens cIDNA FLJ45377 fis, clone 9 UP 4.86E-04 AK127309 BRHIP3019956 Homo sapiens FLJ44048 protein (FLJ44048), 8.93 UP 4.37E-04 NM_2074 mRNA 82 hx89g05.xl NCICGAPKidi 1 Homo sapiens 8.92 UP 6.16E-04 BE464407 cODNA clone IMAGE:3195032 3, mRNA sequence Homo sapiens cytochrome P450, family 4, 8.59 UP 1 .35E-04 NM_1780 subfamily X, polypeptide 1 (CYP4X1), mRNA 33 Homo sapiens collagen, type XI, alpha 1 8.58 UP 4.86E-04 NM_001 8 (COLl1 Al), transcript variant A, mRNA 54 Homo sapiens fibrinogen, B beta polypeptide 8.52 UP 5.39E-04 NM_0051 (FGB), mRNA 41 Homo sapiens SRY (sex determining region 8.52 UP 6.46E-05 NM_0224 box 17 (SOX17), mRNA 54 A1651524 wbO6gO7.xl NCI_CGAPGC6 Homo sapiens 8.5 UP 3.47E-04 cODNA clone IMAGE:2304924 3, mRNA sequence A1288404 qv89bOl.xl NCICGAPUt2 Homo sapiens 8.22 UP 3.47E-04 cODNA clone IMAGE: 1988713 3, mRNA sequence 24/05/016,15735 speci gp,2 4 1 242 Homo sapiens mRNA full length insert cDNA 8.12 UP 1.82E-04 AL359058 clone EUROIMAGE 592473 Homo sapiens matrix metal loproteinase 13 7.92 UP 2.93E-04 NM_0024 (collagenase 3) (MMP13), mRNA 27 AJ318805 Homo sapiens adipose tissue Homo 7.91 U P 1.03E-04 AJ318805 sapiens cDNA clone 2040, mRNA sequence Homo sapiens, clone IMAGE:2960615, mRNA 7.83 UP 6.63E-05 BC0331 24 B1561641 603256058F1 NIHMGC_97 Homo sapiens 7.82 UP 1.18E-03 cONA clone IMAGE:5298374 5, mRNA sequence Homo sapiens cDNA FLJ30398 fis, clone 7.67 UP 1.12E-03 AK054960 BRACE2008402, highly similar to Homo sapiens steroid receptor RNA activator isoform 3 mRNA Homo sapiens zinc finger protein 42 (ZFP42), 7.64 UP 1.40E-04 NM_1749 mRNA 00 Homo sapiens acid phosphatase 1, soluble 7.6 UP 1.36E-03 NM_0070 (ACP1), transcript variant 2, mRNA 99 Homo sapiens, Similar to otoconin 90, clone 7.54 UiP 6.63E-05 BC015108 IMAGE:4044247, mRNA A1640484 wa27fOl xl NCICGAPKidli1 Homo sapiens 7.49 UP 1.03E-03 clDNA clone IMAGE:2299321 3, mRNA sequence Homo sapiens clDNA FLJ 10237 fis, clone 7.49 UP 9.13E-04 AK001099 HEMBB1000438 Homo sapiens mRNA for KlAA1 211 protein, 7.34 UP 7.16E-05 AB033037 partial cds 24/05/06,15735 speci gp, 24 2 243 Homo sapiens, clone IMAGE:4822266, mRNA 7.29 UP 1.67E-04 BC033567 Homo sapiens autocrine motility factor receptor 7.23 UP 3.06E-04 NM_001 1 (AMFR), transcript variant 1, mRNA 44 A1792194 ovO3cO2.y5 NCI_CGAPKid3 Homo sapiens 7.23 UP 4.37E-04 cIDNA clone IMAGE: 1636226 5, mRNA sequence A1939297 oy5OgO8.x5 NCI_CGAPBrn23 Homo sapiens 7.21 U P 1.87E-04 clDNA clone IMAGE:1669310 3, mRNA sequence UI-H-BW1-amf-c-08-O-UI.sl NCI CGAP Sub7 7.17 UP 8.19E-05 BF512544 Homo sapiens cONA clone IMAGE:3069687 3, mRNA sequence Homo sapiens nuclear receptor subfamily 2, 7.09 UP 6.63E-05 NM_0056 group F, member 1 (NR2F1), mRNA 54 H94320 yvl 8bl O.sl Soares fetal liver spleen 1 NFLS 6.65 UP 2.20E-03 Homo sapiens cODNA clone IMAGE:243067 3, mRNA sequence Homo sapiens growth differentiation factor 5 6.5 UP 1.74E-03 NM_0005 (cartilage-derived morphogenetic protein-i) 57 (GDF5), mRNA H15096 ym29el1.r0 Soares infant brain 1iNIB Homo 6.48 UP 5.09E-05 sapiens cIDNA clone IMAGE:49250 5, mRNA sequence Homo sapiens neuro-oncological ventral 6.25 UP 5.77E-05 NM_0025 antigen 1 (NOVAl), transcript variant 1, mRNA Homo sapiens fibroblast growth factor binding 6.13 UP 1.03E-04 NM_0051 protein 1 (FGFBP1), mRNA 24/05/06,15735 speci gp.243 244 IDUI-E-EJ0-ahr-j-07-0-UI.sl UI-E-EJO Homo 6.1 UP 1.23E-03 BM67527 sapiens cIDNA clone UI-E-EJO-ahr-j-07-0-UI 3, 0 mRNA sequence el O.xl NCICGAPLu28 Homo sapiens 6.09 UP 1 .09E-04 V) AW26854 cIDNA clone IMAGE:2816682 3, mRNA N0 sequence Homo sapiens cathepsin H (CTSH), transcript 6.03 UP 1.03E-04 NM_0043 variant 1, mRNA c-I IDAGENCOURT_6432296 NIHMGC_71 Homo 5.97 UP 7.63E-05 BM46833 sapiens cODNA clone IMAGE:5535773 5, mRNA c-I2 sequence Homo sapiens ankyrin repeat domain 30A 5.87 UP 3.09E-03 NM_0529 (ANKRD3OA), mRNA 97 Homo sapiens cODNA FLJ41325 fis, clone 5.81 U P 3.81 E-04 AK123319 BRAMY2046871 Homo sapiens Kruppel-Iike factor 4 (gut) 5.77 UP i1.81 E-04 NM_0042 (KLF4), mRNA Homo sapiens cIDNA clone IMAGE:5295023, 5.76 UP 2.39E-03 BC042976 partial cds obO hO5.sl NOIOGAPKid3 Homo sapiens 5.61 U P 3.06E-03 AA740671 cODNA clone IMAGE: 1322457 3, mRNA sequence Homo sapiens cyclic nucleotide gated channel 5.53 UP 2.39E-03 NM_0000 alpha 1 (CNGA1), mRNA 87 Homo sapiens brain expressed, X-linked 1 5.52 UP 1.07E-03 NM_0184 (BEXi), mRNA 76 24/05/06,15735 speci gp,244 245 BX107838 NCl_CGAP_Lu5 Homo sapiens 5.41 U P 2.69E-03 BX1 07838 cDNA clone IMAGp998A1 53853 IMAGE: 1521686, mRNA sequence Homo sapiens similar to CG3714 gene product 5.36 UP 5.77E-05 NM_1452 (PP3856), mRNA 01 Homo sapiens single-minded homolog 2 5.34 UP 7.88E-05 NM_0050 (Drosophila) (SIM2), transcript variant SIM2, 69 mRNA Homo sapiens dehydrogenase/reductase (SDR 5.32 UP 4.71 E-04 NM_0047 family) member 3 (DHRS3), mRNA 53 Homo sapiens limbic system-associated 5.32 UP 6.88E-04 NM_0023 membrane protein (LSAMP), mRNA 38 Homo sapiens solute carrier family 38, member 5.28 UP 3.14E-03 NM_0335 5 (SLC38A5), mRNA 18 BX1 17317 NCI_CGAP_Co3 Homo sapiens 5.22 UP 1.36E-03 BX1 17317 cIDNA clone I MAGp998E242234 IMAGE:900095, mRNA sequence K-EST0159876 L8SCKO Homo sapiens cIDNA 5.21 U P 1.22E-03 OBI 15754 clone L8SCKO-8-H08 5, mRNA sequence Homo sapiens mRNA; cDNA DKFZp547DO23 5.18 UP 5.41 E-04 AL359567 (from clone DKFZp547DO23) Homo sapiens phospholipid scramblase 4 5.13 UP 1.36E-03 NM_0203 (PLSCR4), mRNA 53 Homo sapiens neuro-oncological ventral 5.12 UP 9.13E-04 NM_0025 antigen 1 (NOVAl), transcript variant 1, mRNA 24/05/06.15735 speci gp,245 246 U51694 HSU5 1694 Human normal gingiva Homo sapiens cDNA, mRNA sequence Homo sapiens IGF-11 mRNA-binding protein 1 NM_0065 (IMP-i), mRNA 46 5.11 UP 5.1 UP 1.10E-04 2.50E-03 INO BG57333 7 NM_0067 27 NM_0143 58 NM_0210 13 BM98833 8 602595107171 NIHMGC_79 Homo sapiens cONA clone IMAGE:4724521 5, mRNA sequence Homo sapiens cadherin 10, type 2 (T2cadherin) (CDH 10), mRNA Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 9 (CLECSF9), mRNA Homo sapiens keratin, hair, acidic, 4 (KRTHA4), mRNA UI-H-DHO-asd-f-1 0-0-UI .sl NCI CGAP OHO Homo sapiens cDNA clone IMAGE:5857545 3, mRNA sequence 5.1 UP 5.01 UP 3.47E-03 5.54E-03 36.05 Down 33.84 Down 31.23 Down 25.01 Down 24.69 Down 21.86 Down 20.35 Down 3.68E-04 9.33E-04 4.43E-03 1.5 1E-03 5.74E-03 1 .45E-02 7. 39E-03 Homo sapiens, clone IMAGE:5271 073, mRNA, BC039369 partial cds 601486331 F1 NIHMGC_69 Homo sapiens BE877764 cDNA clone IMAGE:3888943 5, mRNA sequence xs45a09.xl NCICGAPKidl11 Homo sapiens AW30004 cDNA clone IMAGE:2772568 3, mRNA 3 sequence UI-1-BB11p-aye-f-10-0-UI.sl NCICGAPP16 8002582 Homo sapiens cDNA clone UI-1-BB11p-aye-f-10- 1 0-UI 3, mRNA sequence 24/05/06,15735 speci gp,246 247 BQ00350 1 NM_0133 87 UI-H-EI1-azd-p-06-0-UI.sl NCICGAPEli Homo sapiens cDNA clone IMAGE:5847413 3, mRNA sequence Homo sapiens ubiquinol-cytochrome c reductase complex (7.2 kD) (HSPCO51), transcript variant 1, mRNA csl3alQ.xl Human Retinal pigment CA391 258 epitheliumlchoroid cONA (Un-normalized, unamplified): cs Homo sapiens cDNA clone csl3alO 3, mRNA sequence AV702977 ADB Homo sapiens cDNA clone AV702977 ADBCVD08 5, mRNA sequence 19.16 Down 18.22 Down 17.83 Down 17.04 Down 15.4 Down 14.88 Down 9.49E-04 1.43E-04 3.92E-05 1.41 E-02 9.27E-03 1.03E-04 Homo sapiens putative lymphocyte GO/GI switch gene (GOS2), mRNA NM_0157 14 H85497 yv88b07.rl Scares melanocyte 2NbHM Homo sapiens cDNA clone IMAGE:249781 5, mRNA sequence Homo sapiens renal tumor antigen (RAGE), mRNA NM_0142 26 Homo sapiens cDNA FLJ 13585 fis, clone AK023647 PLACE1009150 Homo sapiens cDNA FLJ46426 fis, clone AK128288 THYMU3013897 Homo sapiens NACHT, leucine rich repeat and NM_0178 PYD containing 2 (NALP2), mRNA 52 Homo sapiens iroquois homeobox protein 3 NM_0243 (IRX3), mRNA 36 14.77 Down 14.09 Down 12.83 Down 12.69 Down 12.29 Down 2.43E-03 1 .22E-03 2.34E-02 1.36E-03 1 .29E-02 24/05/06,15735 speci gp.247 -248- Homo sapiens chemokine (C-C motif) ligand 20 (CCL2O), mRNA NM_0045 91 UI-H-BW1-anu-e-05-0-UI.sl NCI_CGAP_Sub7 BF51 5657 Homo sapiens cDNA clone IMAGE:30836011 3, mRNA sequence W69644 zd45flO.rl Soares-fetal-heartNbHH19W Homo sapiens cDNA clone IMAGE:343627 mRNA sequence Homo sapiens mRNA; cDNA DKFZp76210915 AL832916 (from clone DKFZp76210915) Homo sapiens RAS guanyl releasing protein 1 NM_0057 (calcium and DAG-regulated) (RASGRP1), 39 mRNA 7h15g04.xl NCI_CGAP_Col6 Homo sapiens BF000009 cDNA clone IMAGE:3316086 3, mRNA sequence 11. 11 Down 11.02 Down 10.54 Down 9.98 Down 9.82 Down 9.64 Down 9.3 Down 9.27 Down 3.13E-02 1 .26E-02 8.66E-03 1.94E-03 3.85E-03 1.78E-02 1 .50E-04 3.61 E-02 Homo sapiens beta-site APP-cleaving enzyme 2 (BACE2), transcript variant a, mRNA NM_0121 AGENCOURT_10399817 NIHMGC_82 Homo BU569937 sapiens cDNA clone IMAGE:6618011 5, mRNA sequence Homo sapiens hepatitis A virus cellular receptor NM_0327 2 (HAVCR2), mRNA 82 Homo sapiens normal mucosa of esophagus NM_1979 specific 1 (NMES1), transcript variant 1, mRNA Homo sapiens tumor necrosis factor (ligand) NM_0038 superfamily, member 10 (TNFSF1 mRNA 8.92 Down 6.61 E-03 8.82 Down 8.08 Down 4.1 OE-03 2.84E-04 24/05/06,15735 speci gp,248 249 Homo sapiens NADH dehydrogenase 7.99 Down 1.59E-02 NM_0142 (ubiquinone) 1 alpha subcomplex, 8, l9kDa 22 (NDUFA8), nuclear gene encoding mitochondrial protein, mRNA V)Homo sapiens protocadherin beta 9 (PCDHB9), 7.85 Down 7.39E-03 NM_0191 mRNA 19 Homo sapiens KIAA071 1 gene product 6.89 Down 9.61 INM_0148 (KIAA71 mRNA (Ni 67 Ul-H-B14-apf-b-11-0-Ul.sl NCOCGAPSub8 6.85 Down 8.97E-05 BF509573 Homo sapiens cDNA clone IMAGE:3086949 3, mRNA sequence UlI-BC1p-auz-h-01-0-UI.sl NCICGAPP13 6.44 Down 5.30E-02 BQ01277 Homo sapiens cDNA clone UI-1 -BC1 p-auz-h- 4 01-0-UI 3, mRNA sequence Homo sapiens transmembrane protein 6.32 Down 2.36E-02 NM_0188 SHREW (SHREWi), mRNA 36 UI-H-BI1-adz-d-02-O-UI.sl NCI CGAP Sub3 6.28 Down 1.03E-04 AW1 3906 Homo sapiens cDNA clone IMAGE:2718387 3, 6 mRNA sequence Homo sapiens armadillo repeat containing 4 6.17 Down 2.20E-03 NM_0180 (ARMC4), mRNA 76 B1759570 603046987F1 NIHMGC_1 16 Homo sapiens 6.03 Down 5.06E-02 cDNA clone IMAGE:5187285 5, mRNA sequence Homo sapiens forkhead box Al (FOXAl), 5.79 Down 1 .03E-04 NM_0044 mRNA 96 Homo sapiens forkhead box El (thyroid 5.48 Down 6.27E-05 24/05/06,15735 speci gp.249 -250- NM_0044 transcription factor 2) (FOXE mRNA 73 Homo sapiens a disintegrin-like and 5.35 Down 1.87E-04 NM_1829 metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9 (ADAMTS9), transcript variant 1, mRNA A1830524 wh52c02.xl NCICGAPKidi 11 Homo sapiens 5.34 Down 3.42E-02 cDNA clone IMAGE:2384354 3, mRNA sequence Homo sapiens Rac/Cdc42 guanine nucleotide 5.18 Down 1.41 E-03 NM_0048 exchange factor (GEF) 6 (ARHGEF6), mRNA Homo sapiens cDNA: FLJ23313 fis, clone 5.09 Down 1.49E-04 AK026966 HEP11919 Homo sapiens hypothetical protein L0C339535, 5.03 Down 3.36E-02 BC044843 mRNA (cDNA clone IMAGE:5186761), partial cds X02851 Human mRNA for interleukin-1 precursor (pre 5.03 Down 8.60E-03 IL-i) 24/05/06,15735 speci -251 TABLE VII E: GENES THAT WERE DIFFERENTIALLY EXPRESSED AT LEAST 5 FOLD IN AF-I VERSUS AF-11 CELLS Gene Gene Name Average Direction adj. p- Identifier fold value change AF-l vs AF- D52654 HUMO84DO2B Clontech human fetal brain 398.37 Up 8.54E-05 polyA+ mRNA (#6535) Homo sapiens cDNA clone GEN-084D02 5, mRNA sequence Homo sapiens collagen, type 11l, alpha 1 228.59 Up 5.20E-05 NM_0000 (Ehlers-Danlos syndrome type IV, autosomal dominant) (COL3A), mRNA Homo sapiens SRY (sex determining region 144.06 Up 2.10E-04 NM_0070 box 21 (SOX2I), mRNA 84 Homo sapiens cDNA: FLJ23131 fis, clone 88.3 Up 7.11 AK02678 LNG08502 4 Homo sapiens, Similar to arylacetamide 52.67 Up 1.31 BC01434 deacetylase, clone IMAGE:3934567, mRNA 4 UI-H-El1-azd-p-06-0-UI.sl NOICGAPEli 52.33 Up 6.55E-05 BQ00350 Homo sapiens cDNA clone IMAGE:5847413 3, 1 mRNA sequence UI-1-BB11p-aye-f-10-0-UI.sl NClCGAPP16 45.25 Up 5.46E-05 BQ02582 Homo sapiens cDNA clone UI1-1-BB11p-aye-f-10- 1 0-UI 3, mRNA sequence Homo sapiens Ras interacting protein 1 43.27 Up 2.20E-04 NM_0178 (RASIPi), mRNA 24/05/06,15735 speci gp,23 I -252- UI-H-BW1-anu-e-05-0-UI.sl NCICGAPSub7 42.11 Up 1.69E-05 BF51565 Homo sapiens cDNA clone IMAGE:3083601 3, 7 mRNA sequence Homo sapiens endothelial cell adhesion 41.23 Up 7.66E-05 NM_1389 molecule (ESAM), mRNA 61 Homo sapiens flavoprotein oxidoreductase 39.24 Up 1 .47E-04 BC04636 MICAL3, mRNA (cDNA clone IMAGE:5737121), 4 with apparent retained intron Homo sapiens cDNA FLJ1 1469 fis, clone 36.94 Up 5.91 E-04 AK02153 HEMBA1001658 1 Homo sapiens epiregulin (EREG), mRNA 36.88 Up 7.51 E-04 NM_0014 32 Homo sapiens twist homolog 1 36.39 Up 1.01 E-04 NM_0004 (acrocephalosyndactyly 3; Saethre-Chotzen 74 syndrome) (Drosophila) (TWISTi), mRNA Homo sapiens dachshund homolog 2 34.9 Up 7.97E-06 NM_0532 (Drosophila) (DACH2), mRNA 81 H85497 yv88b07.rl Soares melanocyte 2NbHM Homo 32.03 Up 1.81 E-04 sapiens cDNA clone IMAGE:249781 5, mRNA sequence Homo sapiens succinate receptor I (SUCNR1), 29.47 Up 2.29E-04 NM_0330 mRNA BX093329 Soares_parathyroid-tumorNbHPA 28.85 Up 6.94E-04 BX09332 Homo sapiens cDNA clone IMAGp998A124183 9 ;IMAGE: 1648403, mRNA sequence Homo sapiens general transcription factor IIIC, 28.2 Up 1.29E-04 24/05/06,15735 speci gp,252 -253- NM_01 22 polypeptide 4, 9OkDa (GTF3C4), mRNA 04 am58g02.xl Johnston frontal cortex Homo 27.99 Up 4.43E-05 A1124557 sapiens cDNA clone IMAGE:1539794 3, mRNA sequence Homo sapiens syntaxin binding protein 6 26.38 Up 9.11 NM_0141 (amisyn) (STXBP6), mRNA 78 U831 15 Human non-lens beta gamma-crystallin like 26.15 Up 3.63E-05 protein (AIMi) mRNA, partial cds Homo sapiens KIAAI 576 protein (KIAA1 576), 25.98 Up 2.56E-05 NM_0209 mRNA 27 Homo sapiens fatty acid binding protein 4, 25.37 Up 4.39E-04 NM_0014 adipocyte (FABP4), mRNA 42 Homo sapiens tumor protein p53 inducible 25.36 Up 1 .84E-04 BC04566 protein 11, mRNA (cDNA clone 6 IMAGE:5298525), containing frame-shift errors Homo sapiens ubiquinol-cytochrome c 24.64 Up 1.47E-04 NM_0133 reductase complex (7.2 kO) (HSPCO51), 87 transcript variant 1, mRNA Homo sapiens cDNA FLJ43464 fis, clone 23.47 Up 3.90E-03 AK12545 OCBBF2036225 3 Homo sapiens unc-5 homolog B elegans) 22.66 Up 9.44E-05 NM_1707 (UNC5B3), mRNA 44 Homo sapiens mRNA for KIAA1912 protein, 22.2 Up 2.69E-05 AB06749 partial cds 9 Homo sapiens glutamine-fructose-6-phosphate 22 Up 9.53E-06 24/05/06,15735 sped gp.253 -254- IND NM_0051 transaminase 2 (GFPT2), mRNA hol 5f06.yl Human Trabecular meshwork 21.26 Up 7.83E-05 CD67733 cONA: hohphq Homo sapiens cDNA clone V)2 ho15f06 5, mRNA sequence Homo sapiens hydroxysteroid (11 -beta) 20.9 Up 4.93E-05 NM_0055 dehydrogenase 1 (HSD11131), transcript variant 1, mRNA Homo sapiens periostin, osteoblast specific 20.5 Up 6.66E-04 NM_0064 factor (POSTN), mRNA Homo sapiens cONA: FLJ23475 fis, clone 20.14 Up 1.OOE-04 AK02712 HS113659 8 O.xl NCICGAPGC6 Homo sapiens 19.91 Up 6.86E-05 A1962169 cDNA clone IMAGE:2474226 3, mRNA sequence Ul-E-EJO-aho-m-22-0-U ri UI-E-EJO Homo 19.86 Up 4.55E-05 BM71346 sapiens cONA clone UI-E-EJO-aho-m-22-0-UI mRNA sequence Homo sapiens KIAA0528 gene product 19.34 Up 2.92E-03 NM_0148 (KIAA0528), mRNA 02 Homo sapiens iroquois homeobox protein 3 19.2 Up 4.93E-05 NM_0243 (IRX3), mRNA 36 Homo sapiens 5-hydroxytryptamine (serotonin) 18.89 Up 5.39E-05 NM_0008 receptor 2B (HTR2B), mRNA 67 Homo sapiens clone 23688 mRNA sequence 17.49 Up 8.17E-05 AF0521 1 24/05/06,15735 specc gp.254 255 Homo sapiens cDNA clone IMAGE:4075924, 16.82 Up 2.28E-03 BC01672 partial cds 2 Homo sapiens hypothetical protein FLJ 10159 16.78 Up 5.98E-06 NM_0180 (FLJ101 59), mRNA 13 N3331 0 yy39glO.sl Soares melanocyte 2NbHM Homo 16.64 Up 1.30E-04 sapiens cDNA clone IMAGE:273666 3, mRNA sequence W38393 zbl5cO7.rl Soares-fetal lungNbHL19W 16.52 Up 1.05E-04 Homo sapiens cDNA clone IMAGE:302124 mRNA sequence R44402 yg37aOl.sl Soares infant brain 1iNIB Homo 16.02 Up 4.93E-05 sapiens cIDNA clone IMAGE:34639 3 similar to contains MER35 repetitive element;, mRNA sequence Homo sapiens PIR domain containing 8 15.99 Up 7.27E-06 NM_0202 (PRDM8), mRNA 26 UI-CF-DU1-aaj-c-16-0-UI.sl UI-CF-DU1 Homo 15.75 Up 3.92E-04 BU6771 6 sapiens cDNA clone UI-CF-DU 1-aaj-c-1 9 3, mRNA sequence Homo sapiens angiopoietin 1 (ANGPT1), 15.5 Up 5.07E-04 NM_001 1 transcript variant 1, mRNA 46 Homo sapiens cDNA FLJ41881 fis, clone 15.42 Up 1.03E-04 AK12387 OCBBF2021833 Homo sapiens glycoprotein hormones, alpha 15.42 Up 2.19E-04 NM_0007 polypeptide (CGA), mRNA Ul-H-B13-akc-g-11-0-Ul.sl NCICGAPSub5 15.03 Up 2.89E-05 24/05/06.15735 speci -256- AW4452 Homo sapiens cONA clone IMAGE:2733908 3, 09 mRNA sequence Homo sapiens, clone IMAGE:4817707, mRNA 14.85 Up 1.69E-03 BC04067 8 Homo sapiens elastin microfibril interfacer 3 14.55 Up 5.78E-05 NM_0528 (EMILIN3), mRNA 46 Homo sapiens histone 1, Hid (HIST'IMID), 14.49 Up 9.77E-03 NM_0053 mRNA U79271 Human clones 23920 and 23921 mRNA 13.86 Up 7.54E-04 sequence UI-E-EJ1-ajr-c-19-0-UI.rl UI-E-EJ1 Homo 13.7 Up 5.94E-04 BQ18638 sapiens cDNA clone UI-E-EJ 1-ajr-c-1 9-0-Ul 9 mRNA sequence Homo sapiens GATA binding protein 2 13.42 Up 1.67E-04 NM_0326 (GATA2), mRNA 38 Homo sapiens collagen, type 1, alpha 2 13.37 Up 1.89E-03 NM_0000 (COL1IA2), mRNA 89 Homo sapiens homeodomain-only protein 13.15 Up 1.03E-04 NM_1 392 (HOP), transcript variant 2, mRNA 11 UI-E-Ci1-afw-p-01-0-UI.sl Ul-E-CI1I Homo 13.08 Up 3.22E-04 BM66392 sapiens cDNA clone UI-E-ClI-afw-p-01-0-UI 3, 8 mRNA sequence Homo sapiens tribbles homolog 2 (Drosophila) 12.66 Up 2.40E-04 NM_0216 (TRIB2), mRNA 43 Homo sapiens dynein, cytoplasmic, 12.59 Up 1.43E-05 24/05106,15735 speci gp,2S6 257 NM_0044 intermediate polypeptide 1 (DNCI1), mRNA 11 Homo sapiens cDNA FLJ46426 fis, clone AK12828 THYMU301 3897 8 Homo sapiens mRNA; cONA DKFZp586N0121 AL13311 (from clone DKFZp586NO121) 8 12.51 Up 8.11 E-04 12.28 Up 2.54E-04 BQ02798 4 NM_001 1 UI-H-COO-arg-e-03-0-UI si NOICGAPSub9 Homo sapiens cDNA clone IMAGE:31 06611 3, mRNA sequence Homo sapiens Rho GOP dissociation inhibitor (GDI) beta (ARHGDIB), mRNA Homo sapiens nuclear factor I/A (NFIA), mRNA 12.2 Up 11.91 Up 11.71 Up 8.14E-05 5.05E-05 6.19E-04 NM_0055 Homo sapiens cDNA FLJ30956 fis, clone AK05551 HCASM2000202 11.56 Up 2.92E-03 Homo sapiens glycoprotein lb (platelet), beta polypeptide (GP1B81), mRNA 11.29 Up 1.18E-03 NM_0004 07 Homo sapiens cDNA FLJ26796 fis, clone AK13030 PRS05079 11.1 Up 1 .24E-03 NM_0123 NM_0581 87 Homo sapiens kinesin family member 4A (KIF4A), mRNA Homo sapiens chromosome 21 open reading frame 63 (C21lorf63), mRNA 11.08 Up 10.78 Up 1 .59E-02 5.06E-04 24/05/06,15735 speci gp,25 7 -258- Homo sapiens colon carcinoma related protein 10.71 Up 3.40E-04 NM_0162 (FLJ38507), mRNA 06 Homo sapiens RAS-like, estrogen-regulated, 10.69 Up 1.36E-04 NM_0329 growth inhibitor (RERG), mRNA 18 Homo sapiens serine protease HTRA3 10.65 Up 2.39E-04 NM_0530 (HTRA3), mRNA 44 Homo sapiens T-cell lymphoma breakpoint 10.47 Up 8.32E-03 NM_1533 associated target 1 (TCBA1), mRNA Homo sapiens hypothetical protein FLJ40873 10.42 Up 2.20E-04 NM_1526 (FLJ40873), mRNA Homo sapiens fibroblast activation protein, 10.39 Up 5.27E-05 NM_0044 alpha (FAP), mRNA Homo sapiens SH3 domain containing ring 10.29 Up 6.33E-04 NM_1525 finger 2 (SH3RF2), mRNA 602136969F1 NIH_MGC_83 Homo sapiens 10.27 Up 4.87E-02 BF67423 cDNA clone IMAGE:4273624 5, mRNA 8 sequence Homo sapiens histone 1, Hla (HIST1H1A), 9.97 Up 1.19E-03 NM_0053 mRNA AV702977 ADB Homo sapiens cDNA clone 9.96 Up 4.43E-05 AV70297 ADBCVD08 5, mRNA sequence 7 Homo sapiens chromosome 16 open reading 9.89 Up 2.28E-03 NM_0246 frame 30 (C16orf30), mRNA 24/05/06,15735 speci gp,258 259 00 Homo sapiens cODNA FLJ 13677 fis, clone 9.82 Up 9.53E-06 AK02373 PLACE101 1982 9 Homo sapiens cONA FLJ42709 fis, clone 9.73 Up 2.38E-02 AK1 2469 BRAMY3007350 9 Homo sapiens v-ets erythroblastosis virus E26 9.56 Up 6.20E-03 NM_0052 oncogene homolog 2 (avian) (ETS2), mRNA 39 Homo sapiens cDNA FLJ34018 fis, clone 9.3 Up 6.30E-04 AK091 33 FCBBF2002801 7 H 15096 ym29ell1.r0 Soares infant brain 1iNIB Homo 9.17 Up 7.83E-05 sapiens cODNA clone IMAGE:49250 5, mRNA sequence Homo sapiens hypothetical protein FLJ10970 9.16 Up 2.02E-03 NM_0182 (FLJ1O97O), mRNA 86 Homo sapiens UDP-Gal:betaGlcNAc beta 1,3- 9.04 Up 1.38E-02 NM_0037 galactosyltransferase, polypeptide 2 83 (B33GALT2), mRNA Homo sapiens BH-protocadherin (brain-heart) 8.94 Up 1.53E-04 NM_0324 (PCDH7), transcript variant c, mRNA 57 Homo sapiens phospholipase C, beta 1 8.82 Up 3.03E-03 NM_0151 (phosphoinositide-specific) (PLCB1), transcript 92 variant 1, mRNA Homo sapiens histone 1, H2am (HIST1H2AM), 8.75 Up 5.60E-03 NM_0035 mRNA 14 ox55c02.sl Soares-total-fetusNb2HF8_9w 8.68 Up 2.98E-03 24/05/06,15735 speci gp,259 260 A1082507 Homo sapiens cDNA clone IMAGE: 1660226 3, mRNA sequence Homo sapiens myc target 1 (MYCTI), mRNA 8.61 U p 1.37E-04 NM_0251 07 Homo sapiens, clone IMAGE:4730399, mRNA 8.56 Up 2.94E-04 BC03600 4 601765592F1 NIHMGC_53 Homo sapiens 8.47 Up 1.99E-03 BF02935 cDNA clone IMAGE:3997510 5, mRNA 6 sequence Homo sapiens slit homolog 2 (Drosophila) 8.47 Up 8.47E-04 NM_0047 (SLIT2), mRNA 87 ir42e09.xl HR85 islet Homo sapiens cDNA 8.46 Up 8.95E-04 CA86558 clone IMAGE:6547889 3, mRNA sequence 6 Homo sapiens potassium intermediate/small 8.37 Up 2.28E-05 NM 0216 conductance calcium-activated channel, 14 subfamily N, member 2 (KCNN2), transcript variant 1, mRNA Homo sapiens integrin, beta-like 1 (with EGE- 8.31 U p 2.21 E-04 NM_0047 like repeat domains) (ITGBL1), mRNA 91 Homo sapiens cysteine and tyrosine-rich 1 8.12 Up 8.96E-05 NM_0529 (CYYR1), mRNA 54 Homo sapiens chromosome 20 open reading 8.1 Up 4.12E-04 NM_0328 frame 100 (C20orflOO), mRNA 83 BX1 06577 Soares_NhHMPu_Si Homo sapiens 8.06 Up 7.14E-05 BX10657 cDNA clone IMAGp998H131854;, 24/05/06,15735 speci gp, 26 0 -261 7 IMAGE:754236, mRNA sequence Homo sapiens mRNA for FLJO0204 protein 7.95 Up 2.59E-04 AK07413 1 Homo sapiens hypothetical protein FLJ 12604 7.88 Up 4.06E-04 NM_0246 (FLJ12604), mRNA 21 Homo sapiens mRNA; cONA DKFZp686P0492 7.84 U p 8.97E-05 BX64754 (from clone 0 KFZp686P0492) 1 Homo sapiens BXMAS2-1 0 (BXMAS2-1 7.78 Up 5.05E-04 NM_1450 mRNA 16 UI-H-FL1-bgx-o-20-0-UI.sl NCICGAPFLi 7.7 Up 1.84E-04 BU63436 Homo sapiens cDNA clone UI-H-FL1-bgx-o-20- 3 0-UI 3, mRNA sequence tf23h06.x5 NCICGAPBrn23 Homo sapiens 7.49 Up 1.21 E-04 A1939462 cDNA clone IMAGE:2097083 3, mRNA sequence Homo sapiens nudix (nucleoside diphosphate 7.47 Up 5.46E-05 NM_1531 linked moiety X)-type motif 10 (NUDT1 0), 83 mRNA UI-1-BC1p-asi-a-02-0-UI.sl NCICGAPP13 7.43 Up 1.38E-03 BQ01 154 Homo sapiens cDNA clone UI-1 -BC1 p-asi-a-02- 0-UI 3, mRNA sequence T47612 ybl 5hO3.si Stratagene placenta (#937225) 7.41 Up 4.13E-03 Homo sapiens cDNA clone IMAGE:71285 3, mRNA sequence Homo sapiens Rho GTPase activating protein 7.36 Up 2.50E-04 NM_0208 20 (AR HGAP2O), mRNA 09 Homo sapiens, clone IMAGE:5277693, mRNA 7.25 Up 3.63E-03 24/05/06.15735 speci gp,261 -262- BC04237 8 Homo sapiens ovarian cancer related tumor 7.11 Up 2.19E-03 AF41444 marker CA1 25 mRNA, complete cds 2 Homo sapiens follistatin (EST), transcript 7.1 Up 5.52E-04 NM_0063 variant FST317, mRNA ojl6hO2.yl Human lacrimal gland, unamplified: 7.09 Up 5.06E-04 CD72300 oj Homo sapiens cDNA clone oj 16h02 5, mRNA 6 sequence Homo sapiens cDNA clone IMAGE:2984900, 7.02 Up 4.43E-05 BC02746 containing frame-shift errors Homo sapiens Sadi and UNC84 domain 6.94 Up 1.34E-03 NM_1527 containing 1 (SUNCi), mRNA 82 Homo sapiens cDNA FLJ4301 1 fis, clone 6.91 U p 3.36E-03 AK1 2500 BRTHA20 15853 1 Homo sapiens hypothetical protein MGC34830 6.89 Up 1.08E-04 NM_1523 (MGC34830), rnRNA 14 Homo sapiens unc-5 homolog D elegans) 6.88 Up 3.33E-04 NM_0808 (UNC51D), mRNA 72 Homo sapiens putative lymphocyte GO/Gi 6.86 Up 1.34E-03 NM_0157 switch gene (GOS2), mRNA 14 Homo sapiens tropomnodulin 2 (neuronal) 6.83 Up 5.11 E-03 NM_0145 (TMOD2), mRNA 48 24/05/06,15735 speci gp,262 263 Homo sapiens protease, serine, 3 (mesotrypsin) 6.82 Up 1.28E-03 NM_0027 (PRSS3), mRNA 71 Homo sapiens elongation factor, RNA 6.75 Up 3.OOE-03 NM_0120 polymerase 11, 2 (ELL-2), mRNA 81 wu97glO.xl NCICGAPKid3 Homo sapiens 6.7 Up 2.11 E-03 AW0255 cODNA clone IMAGE:2528034 3, mRNA 56 sequence Homo sapiens neurotrimin (HNT), mRNA 6.7 Up 1.84E-04 NM_0165 22 Homo sapiens cDNA FLJ 10417 fis, clone 6.68 Up 6.41 E-04 AK00127 NT2RP1000112 9 Homo sapiens B-cell CL~llymphoma 7A 6.6 Up 1 .79E-02 NM_0209 (BCL7A), mRNA 93 Homo sapiens myopalladin (FLJ 14437), mRNA 6.55 Up 5.46E-05 NM_0325 78 Homo sapiens hypothetical protein FLJ21986 6.47 Up 9.10E-04 NM_0249 (FLJ21986), mRNA 13 Homo sapiens ABI gene family, member 3 6.45 Up 1 .07E-02 NM_0164 (ABI3), mRNA 28 Homo sapiens chondroitin betal ,4 N- 6.44 Up 1 .75E-04 NM_0183 acetylgalactosaminyltransferase (ChGn), mRNA 71 AGENCOURT_6457446 NIHMGC_88 Homo 6.37 Up 1.34E-03 BM80292 sapiens cDNA clone IMAGE:5560288 5, mRNA 24/05/06,15735 speci gp.263 264 0 sequence Homo sapiens inversin (INVS), transcript 6.32 Up 6.46E-05 NM_1 832 variant 2, mRNA og77h08.sl NCICGAP_0v8 Homo sapiens 6.31 U p 3.33E-04 AA90881 cDNA clone IMAGE:1454367 3, mRNA sequence UI-H-DH1-axg-p-14-0-U.sl NCICGAPOHi 6.28 Up 4.40E-04 BQ02 166 Homo sapiens cDNA clone IMAGE:5828605 3, 1 mRNA sequence Homo sapiens lymphocyte antigen 6 complex, 6.24 Up 1.36E-02 NM_01 75 locus K (LY6K), mRNA 27 Homo sapiens hypothetical protein L0C222171 6.23 Up 1.76E-04 NM_1758 (L0C222171), mRNA 87 UI-E-EJ1-aje-1-1O-O-UI.rl UI-E-EJ1 Homo 6.18 Up 1.44E-04 BM92959 sapiens cONA clone UI-E-EJ1-aje-l-10-0-UI 8 mRNA sequence wd24c09.xl SoaresNFLTGBCSI Homo 6.17 Up 9.74E-03 A191 1163 sapiens cONA clone IMAGE:2329072 3, mRNA sequence Homo sapiens cONA: FLJ21 000 fis, clone 6.17 Up 2.15E-04 AK02465 CAE03359 3 Homo sapiens cONA FLJ42917 fis, clone 6.15 Up 2.20E-03 AK12490 BRHIP3026335 7 Homo sapiens angiopoietin 2 (ANGPT2), 6.14 Up 1.24E-04 NM_0011 mRNA 47 Homo sapiens adrenomedullin (ADM), mRNA 6.13 Up 1.72E-04 24/05/06.15735 speci gp.26 4 265 INO NM_001 1 24 an3l gO4.x5 Gessler Wilms tumor Homo 6.11 Up 5.78E-05 A1733665 sapiens cONA clone IMAGE: 1700310 3, mRNA sequence Homo sapiens PDZ domain protein GIPC2 6.09 Up 1.81 E-04 NM_0176 (GIPC2), mRNA Homo sapiens tyrosine 3- 5.96 Up 5.04E-03 NM_0034 monooxygenase/tryptophan activation protein, eta polypeptide (YWHAH), (Ni mRNA Homo sapiens solute carrier family 26, member 5.95 Up 2.72E-02 NM_0004 4 (SLC26A4), mRNA 41 Homo sapiens mRNA; cONA 5.93 Up 1.86E-03 BX64832 DKFZp686K1O163 (from clone 3 DKFZp686K1O163) Ul-H-B12-agv-h-04-0-Ul.sl NCICGAPSub4 5.93 Up 5.03E-03 AW2917 Homo sapiens cDNA clone IMAGE:2725855 3, mRNA sequence Homo sapiens inhibitor of DNA binding 4, 5.9 Up 2.39E-03 NM_0015 dominant negative helix-loop-helix protein (0D4), 46 mRNA Homo sapiens sialyltransferase 7 ((alpha-N- 5.88 Up 5.92E-04 NM_1529 acetylneuraminyl-2, 3-beta-galactosyl-1,3)-N- 96 acetyl galactosaminide alpha-2,6sialyltransferase) C (SIAT7C), mRNA AGENCOURT_6544282 NIHMGC_88 Homo 5.8 Up 7.12E-03 BM55619 sapiens cDNA clone IMAGE:5550173 5, mRNA 1 sequence Homo sapiens MIDi interacting protein 1 5.75 Up 3.63E-03 NM_0212 (gastrulation specific G12-like (zebrafish)) 24/05/06,1a5735 spect gp. 26 S 266 ID42 (MIDl1Ii), mRNA 603392040F1 NIHMGC_90 Homo sapiens 5.69 Up 3.11 E-03 B1868709 cDNA clone IMAGE:5402337 5, mRNA sequence V)UI-E-EJO-ahi-a-13-0-UI.rl UI-E-EJO Homo 5.68 Up 1.54E-03 BM7131 1 sapiens cIDNA clone UI-E-EJO-ahi-a-1 3-0-Ul 4 mRNA sequence C1Homo sapiens mRNA; cIDNA DKFZp586N2020 5.68 Up 4.15E-04 AL04944 (from clone DKFZp586N2020) 3 Homo sapiens SMAID, mothers against DPP 5.65 Up 6.72E-04 NM_0059 homolog 9 (Drosophila) (SMAD9), mRNA Homo sapiens activating signal cointegrator 1 5.63 Up 6.59E-03 NM_0068 complex subunit 3 (ASCC3), mRNA 28 Homo sapiens follistatin (FST), transcript 5.62 Up 9.70E-05 NM_0063 variant FST317, mRNA R22189 yh26a02.sl Soares placenta Nb2HP Homo 5.62 Up 1.08E-04 sapiens cIDNA clone IMAGE: 130826 3, mRNA sequence Homo sapiens PR domain containing 8 5.57 Up 3.04E-02 NM_0202 (PRDM8), mRNA 26 R01937 ye85h04.sl Soares fetal liver spleen 1 NFLS 5.56 Up 1.87E-03 Homo sapiens cIDNA clone IMAGE: 124567 3 similar to gb:L13923 FIBRILLIN 1 PRECURSOR (HUMAN)-,, mRNA sequence UI-E-EOI -aiy-a-22-0-UI. ri UI-E-EO1 Homo 5.52 Up 2.40E-02 BM72406 sapiens cIDNA clone UI-E-EO1 -aiy-a-22-0-UI 2 mRNA sequence 24/05/06,15735 speci gp.266 267 Homo sapiens potassium voltage-gated 5.51 Up 1 .35E-02 NM_0806 channel, Isk-related family, member 4 (KCNE4), 71 mRNA AL558097 Homo sapiens T CELLS (JURKAT 5.5 Up 2.82E-02 AL55809 CELL LINE) COT 10-NORMALIZED Homo 7 sapiens cODNA clone CSODJO02YD14 mRNA sequence qa65e08.xl Soares-fetal-heartNbHH19W 5.49 Up 7.59E-03 A1090760 Homo sapiens cIDNA clone IMAGE:1691654 3, mRNA sequence Homo sapiens transcription factor 7-like 2 5.48 Up 4.57E-04 NM_0307 cell specific, HMG-box) (TCF7L2), mRNA 56 Homo sapiens mRNA; cODNA DKFZp762I0915 5.47 Up 1.84E-04 AL83291 (from clone DKFZp76210915) 6 Homo sapiens carboxypeptidase A3 (mast cell) 5.46 Up 6.04E-04 NM_0018 (CPA3), mRNA UI-H-DT1-awc-h-03-0-UI.sl NCI_CGAP_DT1 5.45 Up 2.71 E-04 BM99830 Homo sapiens cIDNA clone IMAGE:5887538 3, 3 mRNA sequence Homo sapiens nucleoporin l55kDa (NUPi 55), 5.45 Up 4.65E-02 NM_0042 transcript variant 2, mRNA 98 Homo sapiens neurexin 3 (NRXN3), transcript 5.44 Up 1. 15E-04 NM_1389 variant beta, mRNA Homo sapiens nuclear receptor subfamily 2, 5.43 Up 1.74E-04 NM_0056 group F, member 1 (NR2F1), mRNA 54 Homo sapiens pallidin homolog (mouse) 5.38 Up 1. 17E-02 24/05/06,15735 speci gp, 267 -268- NM_0123 (PLIDN), mRNA 88 Homo sapiens transducin (beta)-like lY-linked 5.38 Up 4.42E-02 NM_0332 (TBL1Y), transcript variant 1, mRNA 84 Homo sapiens cODNA FLJ40329 fis, clone 5.38 Up 1.83E-04 AK09764 TEST12031418, weakly similar to TRYPSIN I- 8 P1 PRECURSOR (EC 3.4.21.4) Homo sapiens cDNA FLJ42572 fis, clone 5.35 Up 4.57E-04 AK12456 BRACE3008092 3 Homo sapiens interleukin 7 receptor (IL7R), 5.31 U p 8.90E-04 NM_0021 mRNA cl73d12.zl Hembase; Erythroid Precursor Cells 5.27 Up 6.26E-04 BU661 54 (LCB:cl library) Homo sapiens clDNA clone 3 c173d12 5, mRNA sequence Homo sapiens clDNA FLJ35052 fis, clone 5.26 Up 4.82E-03 AK09237 OCBBF2O1 8234, highly similar to GUANINE 1 NUCLEOTIDE-BINDING PROTEIN G(I)IG(S)IG(O) GAMMA-2 SUBUNIT (G GAMMA-I) Homo sapiens major histocompatibility 5.24 Up 5.25E-04 NM_0335 complex, class 11, OIP alpha 1 (HLA-DPA1), 54 mRNA Homo sapiens hypothetical protein FLJ30634 5.23 Up 2.64E-02 NM_1530 (FLJ30634), mRNA 14 aaO4dO3.sl Soares_NhHMPu_SI Homo 5.21 Up 7.36E-04 AA45507 sapiens cDNA clone IMAGE:812261 3, mRNA 1 sequence Homo sapiens solute carrier organic anion 5.2 Up 1.46E-04 NM_0056 transporter family, member 2A1 (SLC02A1), 24/05/06.15735 speci gp,268 -269mRNA Homo sapiens platelet factor 4 (chemokine 5.19 Up 3.64E-04 NM_0026 X-C motif) ligand 4) (PF4), mRNA 19 zr47elO.rl Soares_NhHMPu_Si Homo sapiens 5.17 Up 1. 91 E-04 AA23264 cDNA clone IMAGE:666570 5, mRNA 3 sequence Homo sapiens protein phosphatase 1, 5.14 Up 1.29E-04 NM_0053 regulatory (inhibitor) subunit 3C (PPP1 R3C), 98 mRNA ir49c12.xl HR85 islet Homo sapiens cIDNA 5.13 Up 1.89E-04 CA84359 clone IMAGE:6548544 3, mRNA sequence 2 UI-E-EJO-aig-o-17-0-UI.sl UI-E-EJO Homo 5.11 Up 3.39E-03 BM67797 sapiens cONA clone UI-E-EJO-aig-o-1 7-0-UI 3, 8 mRNA sequence Homo sapiens RNA binding motif protein 19 5.1 Up 1.84E-04 NM_0161 (RBM19), mRNA 96 BX1 05152 Soares-testisNHT Homo sapiens 5.1 Up 3.96E-05 BX1 0515 cIDNA clone IMAGp998J212575 2 IMAGE: 1031156, mRNA sequence Homo sapiens fibulin 5 (FBLN5), mRNA 5.06 Up 1.18E-03 NM_0063 29 Homo sapiens CD1C antigen, c polypeptide 5.06 Up 1.54E-04 NM_0017 (CDiC), mRNA Homo sapiens RNA binding motif protein 15 5.06 Up 2.82E-04 NM_0227 (RBM15), mRNA 68 N49730 yzO6al2.sl 5.03 Up 9.95E-05 24/05/06,15735 speci gp,269 -270- Soares -multiple -sclerosis_-2NbHMSP Homo sapiens cONA clone IMAGE:282238 3 similar to contains Alu repetitive element; conta ins element PTR5 repetitive element;, mRNA sequence Homo sapiens cONA FLJ42866 fis, clone AK12485 BRHIP2020622 6 Homo sapiens ribosomal protein S4, Y-linked 1 NM_0010 (RPS4YI), mRNA 08 Homo sapiens ribosomal protein S4, Y-linked 2 NM_1389 (RPS4Y2), mRNA 63 Homo sapiens SRY (sex determining region Y)- NM_0224 box 17 (SOX17), mRNA 54 RST39494 Athersys RAGE Library Homo BG21972 sapiens cDNA, mRNA sequence 9 H70730 yu69elO.rl Weizmann Olfactory Epithelium Homo sapiens cDNA clone IMAGE:239082 mRNA sequence Homo sapiens Smcy homolog, Y-linked NM_0046 (mouse) (SMOIY), mRNA 53 Homo sapiens mRNA for KIAA1 154 protein, AB03298 partial cds 0 wh56c02.xl NCICGAPKidl11 Homo sapiens A1765021 cDNA clone IMAGE:2384738 3, mRNA sequence 5.02 Up 1 .25E-03 456.26 Down 7.09E-06 423.01 Down 1 .53E-06 404.8 Down 264.66 Down 3.71 E-06 2.05E-06 256.95 Down 1.53E-06 252.16 Down 227.36 Down 7.51 E-07 4.39E-05 212.62 Down 1.69E-05 24/05/06,15735 speci gp,270 271 Homo sapiens erythrocyte membrane protein NM_01 23 band 4. 1-like 3 (EPB41 L3), mRNA 07 Homo sapiens DEAD (Asp-Glu-Ala-Asp) box NM_0046 polypeptide 3, Y-linked (DDX3Y), mRNA Homo sapiens CD24 antigen (small cell lung NM_0 132 carcinoma cluster 4 antigen) (CD24), mRNA Homo sapiens tripartite motif-containing 55 NM_1 840 (TRIM55), transcript variant 4, mRNA 87 Homo sapiens cDNA FLJ 13569 fis, clone AK02363 PLACE1008369 1 BX102632 NCICGAPCo3 Homo sapiens BX10263 cDNA clone IMAGp998J052307; 2 IMAGE:928228, mRNA sequence Homo sapiens prepronociceptin (PNOC), NM_0062 mRNA 28 Homo sapiens potassium inward ly-rectifying NM_0186 channel, subfamily J, member 16 (KCNJ16), 58 transcript variant 1, mRNA Homo sapiens zinc finger protein, Y-linked NM_0034 (ZFY), mRNA 11 Homo sapiens a disintegrin-like and NM_0070 metalloprotease (reprolysin type) with 38 thrombospondin type 1 motif, 5 (aggrecanase- 2) (ADAMTS5), mRNA Homo sapiens tripartite motif-containing 55 192.31 Down 184.34 Down 171.2 Down 166.79 Down 163.75 Down 2.12E-06 1 .69E-05 3.78E-07 7.27E-06 2.77E-07 157.63 Down 1.88E-06 144.89 Down 139.61 Down 130.35 Down 126.24 Down 112.25 Down 2.50E-05 4.43E-05 2.77E-07 7.83E-05 1.92E-05 24/05/06,15735 speci gp.271 272 NM_1 840 (TRIM55), transcript variant 4, mRNA 87 Homo sapiens visinin-like 1 (VSNL1), mRNA NM_0033 Homo sapiens copine VIII (CPNE8), mRNA NM_1536 34 Homo sapiens ATP-binding cassette, sub-family NM_0009 B (MOR/TAP), member 1 (ABCB1), mRNA 27 RST16291 Athersys RAGE Library Homo BG1 9705 sapiens cDNA, mRNA sequence 4 Homo sapiens transmembrane 4 superfamily NM_0046 member 4 (TM4SF4), mRNA 17 Homo sapiens ribosomal protein L27a NM_0009 (RPL27A), mRNA Homo sapiens neuroligin 4, Y-Iinked (NLGN4Y), NM_0148 mRNA 93 aj64a03.xl NCICGAPKid3 Homo sapiens A1249696 cDNA clone IMAGE: 1864204 3, mRNA sequence 105.15 Down 2.05E-06 101.79 Down 9.53E-06 94.49 Down 92.27 Down 5.20E-05 2.05E-06 69.46 Down 5.88E-05 63.45 Down 59.4 Down 58.18 Down 2.03E-04 2.05E-06 1 .92E-05 AK09224 Homo sapiens cDNA FLJ34926 fis, clone NT2RP7003319, highly similar to Mus musculus neuralin mRNA 57.12 Down 56.89 Down 2.50E-05 1.80E-05 tb29h06.xl NOI_CGAP_KidI2 Homo sapiens A1335277 cDNA clone IMAGE:2055803 3, mRNA sequence 24/05/06,15735 speci gp,2 7 2 -273- INO Homo sapiens doublecortin domain containing NM_0163 2 (DCDC2), mRNA 56 Homo sapiens neuropilin (NRP) and tolloid NM_1 389 (TLL)-Iike 1 (NET0l), transcript variant 3, 66 mRNA Homo sapiens desmocollin 2 (DSC2), transcript NM_0244 variant Dsc2a, mRNA 22 Homo sapiens membrane component, NM_0318 chromosome 17, surface marker 2 (ovarian 62 carcinoma antigen CA125) (M17S2), transcript variant 3, mRNA 7o1 8c06.xl NCIOGAPKidl 1Homo sapiens BF43103 cDNA clone IMAGE: 3574283 3, mRNA 0 sequence Homo sapiens forkhead box Al (FOXAl), NM_0044 mRNA 96 Homo sapiens leucine rich repeat neuronal 1 NM_0208 (LRRNl), mRNA 49.57 Down 48.88 Down 1.41 E-04 48.6 Down 45.75 Down 45.24 Down 1 .60E-05 5.31 2.90E-05 3.24E-05 44.97 Down 42.8 Down 42.38 Down 2.77E-07 3.33E-05 BF51 254 4 CA4 161 0 6 UI-H-BW1 -amf-c-08-0-UI si NCICGAPSub7 Homo sapiens cDNA clone IMAGE:3069687 3, mRNA sequence UI-H-FEO-bbs-f-1 7-0-UI si NCICGAPFEO Homo sapiens cDNA clone UI-H-FEO-bbs-f-17- 0-UI 3, mRNA sequence 3.24E-05 aj93h05.xl NCICGAPKid3 Homo sapiens A1244954 cDNA clone IMAGE: 1867065 3, mRNA sequence RC1 -CI0045-021 000-021 -f02 C10045 Homo 41.22 Down 40.95 Down 40.6 Down 5.15E-05 9.53E-06 6.53E-05 24/05/06.15735 speci gp, 273 -274- INO BF79809 sapiens cONA, mRNA sequence 8 Homo sapiens matrix metalIloprotei nase 7 NM_0024 (matrilysin, uterine) (MMP7), mRNA 23 UI-CF-DUl1-aaz-f-04-0-Ul.sl UI-CF-DU 1 Homo BU68066 sapiens cDNA clone UI-CF-DU1-aaz-f-04-0-UI 1 3, mRNA sequence Homo sapiens mRNA; cDNA DKFZp564N2216 AL0801O0 (from clone DKFZp564N2216) 3 Homo sapiens Fraser syndrome 1 (FRASi), NM_0250 transcript variant 1, mRNA 74 Homo sapiens eukaryotic translation initiation NM_0046 factor 1A, Y-Iinked (EIF1AY), mRNA 81 Homo sapiens cDNA FLJ39 162 fis, clone AK09648 OCBBF2002376 39.36 Down 37.22 Down 9.07E-05 6.19E-05 37.11 Down 1 .50E-05 36.19 Down 7.09E-06 36.04 Down 35.96 Down 1.84E-04 4.87E-05 Homo sapiens chromosome 14 open reading NM_0181 frame 105 (Cl4orflO05), mRNA 68 Homo sapiens hyaluronan synthase 3 (HAS3), NM_0053 transcript variant 1, mRNA 29 Homo sapiens neurotrophin 3 (NTF3), mRNA NM_0025 27 Homo sapiens dipeptidylpeptidase 4 (CD26, NM_0019 adenosine deaminase complexing protein 2) (DPP4), mRNA 34.11 Down 3.52E-05 33.86 Down 32.19 Down 2.25E-06 1.31 31.89 Down 1.66E-04 24/05/06,15735 speci gp,2 7 4 275 INO Ct Homo sapiens cadherin 6, type 2, K-cadherin (fetal kidney) (CDH6), mRNA 30.7 Down NM_0049 32 BX64864 3 NM_0325 76 NM_0022 76 NM_1524 87 2.59E-05 7.09E-06 Homo sapiens mRNA; cDNA DKFZp686O17106 (from clone DKFZp686O1 7106) 30.56 Down Homo sapiens chromosome Y open reading frame 15B (CYorfl5B), mRNA Homo sapiens keratin 19 (KRT1 mRNA Homo sapiens hypothetical protein FLJ31842 (FLJ31842), mRNA Homo sapiens hypothetical gene supported by AK075564; BC060873 (L0C400451), mRNA Homo sapiens ankyrin repeat domain 2 (stretch responsive muscle) (ANKRD2), mRNA Homo sapiens grancalcin, EF-hand calcium binding protein (GCA), mRNA 30.49 Down 29.34 Down 28.96 Down 2.05E-06 2.84 E-04 2.08E-04 NM_2074 46 NM_0203 49 NM_0121 98 28.29 Down 27.27 Down 27.06 Down 26.58 Down 9.53E-06 1.17E-05 7.97E-04 1.63E-04 Homo sapiens cDNA FLJ32320 fis, clone AK05688 PROST2003537 2 Homo sapiens hypothetical protein FLJ20152 NM_0190 (FLJ20152), mRNA 00 602508665F1 NIHMGC_79 Homo sapiens BG43624 cDNA clone IMAGE:4605617 5, mRNA 25.35 Down 6.39E-05 25.2 Down 7.09E-06 24/05/06,15735 speci gp. 2 7 -276sequence O nx13b02.s1 NCI_CGAP_GC3 Homo sapiens AA73825 cDNA clone IMAGE:1255947 3, mRNA 4 sequence Homo sapiens natriuretic peptide precursor B NM_0025 (NPPB), mRNA 21 Homo sapiens cytochrome P450, family 1, NM_0001 subfamily B, polypeptide 1 (CYP1B1), mRNA 04 Homo sapiens F11 receptor (F11R), transcript NM_0169 variant 1, mRNA 46 Homo sapiens F11 receptor (F11R), transcript NM_0169 variant 1, mRNA 46 Homo sapiens serine-arginine repressor protein NM_0807 (35 kDa) (SRrp35), mRNA 43 Homo sapiens hypothetical protein LOC131368 NM_1750 (LOC131368), mRNA 56 Homo sapiens growth differentiation factor 5 NM_0005 (cartilage-derived morphogenetic protein-1) 57 (GDF5), mRNA Homo sapiens natural killer cell transcript 4 NM_0042 (NK4), mRNA 25.16 Down 24.93 Down 9.53E-06 8.66E-04 24.83 Down 24.8 Down 3.50E-05 4.83E-05 24.38 Down 2.77E-05 23.93 Down 1.02E-05 23.5 Down 4.93E-05 23.37 Down 23.12 Down 22.5 Down 8.14E-05 4.24E-04 BF43104 1 nab31g02.x1 Soares_NSF_F8_9W_OT_PA_P_S1 Homo sapiens cDNA clone IMAGE:3267627 3, mRNA sequence 4.93E-05 24105/06,15735 speci gp. 276 -277- Homo sapiens WD repeat domain 40B NM_1784 (WDR4OB), mRNA wbO6gO7.xl NCICGAPGC6 Homo sapiens A1651524 cDNA clone IMAGE:2304924 3, mRNA sequence NlSC-gfO8f03.xl NCICGAPKidl2 Homo CB04709 sapiens cDNA clone IMAGE:3253013 3, mRNA 21.85 Down 21.78 Down 4.54E-05 4.59E-05 21.63 Down 5.93E-06 sequence zxO3dl2.rl Soares-total-fetusNb2HF8_9w AA44913 Homo sapiens cDNA clone IMAGE:785399 7 mRNA sequence H89053 yw24c06.rl Morton Fetal Cochlea Homo sapiens cONA clone IMAGE:.253162 5, mRNA sequence BX5091 1 7 NM_0005 82 DKFZp686C09280_ri 686 (synonym: hlcc3) Homo sapiens cDNA clone DKFZp686C09280 5, mRNA sequence Homo sapiens secreted phosphoprotein 1 (osteopontin, bone sialoprotein 1, early Tlymphocyte activation 1) (SPIP11), mRNA 21.62 Down 21.41 Down 20.95 Down 20.66 Down 20.37 Down 20.18 Down 2.08E-04 4.16E-03 2.31 6.44E-03 4.83E-05 Homo sapiens cDNA FLJ42883 fis, clone AK12487 BRHIP3006683 3 Homo sapiens cDNA FLJ20068 fis, clone AK00007 C0L01755 5.17E-04 Homo sapiens protein kinase (cAMP- NM_0324 dependent, catalytic) inhibitor beta (PKIB), 71 transcript variant 3, mRNA Homo sapiens cDNA FLJ38457 fis, clone AK09577 FEBRA2020400 20.17 Down 19.57 Down 5.05E-04 1 .69E-05 24/05/06,15735 speci gp,277 -278- INO Homo sapiens a disintegrin-like and NM_1829 metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9 (ADAMTS9), transcript variant 1, mRNA Homo sapiens keratin 8 (KRT8), mRNA NM_0022 73 Homo sapiens potassium channel, subfamily K, NM_0022 member 3 (KCNK3), mRNA 46 Homo sapiens IQ motif containing with AAA NM_0247 domain (IQCA), mRNA 26 Homo sapiens short form transcription factor C- AF05537 MAF (c-maf) mRNA, complete cds 6 Homo sapiens mRNA for KIAA1222 protein, AB03304 partial cds 8 hd44d11.x1 SoaresNFL_T_GBCS1 Homo AW5112 sapiens cDNA clone IMAGE:2912373 3 similar 22 to contains Alu repetitive element;, mRNA sequence Homo sapiens Ras-related associated with NM_0041 diabetes (RRAD), mRNA Homo sapiens collagen, type VIII, alpha 2 NM_0052 (COL8A2), mRNA 02 Homo sapiens neuro-oncological ventral NM_0025 antigen 1 (NOVA1), transcript variant 1, mRNA 19.13 Down 18.92 Down 2.49E-05 9.32E-05 18.9 Down 1.35E-05 18.77 Down 5.32E-04 18.38 Down 1.54E-03 18.16 Down 7.70E-05 17.66 Down 17.32 Down 17.22 Down 17.01 Down 7.79E-04 3.10E-04 1.48E-04 4.66E-06 24/05/06,15735 speci gp.278 -279- INO Homo sapiens fibroblast growth factor binding protein 1 (FGFBP1), mRNA NM_0051 Homo sapiens cDNA FLJ40752 fis, clone AK09807 TRACH2000972 1 Homo sapiens cDNA FLJ14176 fis, clone AK02423 NT2RP20031 01 8 R99527 yq79bl 1.sl Soares fetal liver spleen 1 NFLS Homo sapiens cDNA clone IMAGE:201981 3, mRNA sequence 16.84 Down 16.57 Down 16.33 Down 9.53E-06 1.90E-04 1 .60E-05 NM_0211 02 BQ00340 1 BC03565 6 Homo sapiens serine protease inhibitor, Kunitz type, 2 (SPINT2), mRNA UI-H-EI 1-azd-j-23-0-UI .sl NCIOGAPEli Homo sapiens cDNA clone IMAGE:5847286 3, mRNA sequence Homo sapiens hypothetical protein L0C285835, mRNA (cDNA clone IMAGE:5588650), partial cds 16.15 Down 15.87 Down 15.77 Down 15.49 Down 15.46 Down 15.18 Down 15.04 Down 7.97E-06 4.35E-05 2.50E-04 1.53E-06 3.03E-05 1.OOE-03 2.32E-04 T56535 yb33g07.rl Stratagene fetal spleen (#937205) Homo sapiens cDNA clone IMAGE:73020 mRNA sequence Homo sapiens chromosome 20 open reading NM_1528 frame 58 (C20orf58), mRNA 64 Homo sapiens glypican 4 (GPC4), mRNA NM_0014 48 Homo sapiens crumbs homolog 3 (Drosophila) 14.99 Down 1 .08E-04 24/05/06,15735S speci gp,279 280 NM_1 391 (CRB3), transcript variant 2, mRNA 61 AGENCOURT_8840265 Lupski_sciatic-nerve BQ92483 Homo sapiens cDNA clone IMAGE:6205036 2 mRNA sequence Homo sapiens serum/glucocorticoid regulated NM_0162 kinase 2 (SGK2), transcript variant 2, mRNA 76 UI-H-DHO-aur-k-12-0-UI.sl NOICGAPDHO CA43786 Homo sapiens cDNA clone UI-H-DHO-aur-k-12- 1 0-UI 3, mRNA sequence H89526 yw28b04.r1 Morton Fetal Cochlea Homo sapiens cDNA clone IMAGE:253519 5, mRNA sequence UI-H-FL1-bgt-n-07-0-UI.sl NCICGAPELi BU63316 Homo sapiens cDNA clone UI-H-FL1-bgt-n-07- 3 0-UI 3, mRNA sequence Homo sapiens hemoglobin, delta (HBD), mRNA NM_0005 19 Homo sapiens likely ortholog of mouse NM_0209 neighbor of Punc Eli1 (NOPE), mRNA 62 Homo sapiens lipopolysaccharide-induced TNF NM_0048 factor (LITAF), mRNA 62 Homo sapiens protein tyrosine phosphatase, NM_0028 receptor type, B (PTPRB), mRNA 37 Homo sapiens family with sequence similarity NM_0248 31, member C (FAM31 mRNA 98 14.93 Down 14.91 Down 14.78 Down 14.74 Down 14.62 Down 14.61 Down 1.30E-05 2.20E-05 9.11 3.24E-05 3.96E-05 1.34E-05 14.48 Down 6.78E-05 14.37 Down 14.3 Down 14.27 Down 3.22E-04 1.61 3.50E-05 24/05/06,15735 speci gp,280 -281 Ct Homo sapiens c2lorf7 form B mRNA, complete AF26916 cds 2 14.09 Down 1 .28E-04 Homo sapiens visinin-like 1 (VSNL1), mRNA 14.08 Down 1 .92E-05 NM_0033 Homo sapiens heat shock 70kDa protein 12A, BC04 141 mRNA (cDNA clone IMAGE:52851 93), partial 2 cds tg7OfO4.xl SoaresNhHMPuSi Homo sapiens A1493349 cDNA clone IMAGE:21 14143 3, mRNA sequence 601174523F1 NIHMGC_1 7 Homo sapiens BE29546 cDNA clone IMAGE:3529924 5, mRNA 8 sequence Homo sapiens ectonucleotide NM_0149 pyrophosphatase/phosphodiesterase 4 36 (putative function) (EN PP4), mRNA Homo sapiens ADAMTS-like 3 (ADAMTSL3), NM_2075 mRNA 17 Homo sapiens pre-B-cell leukemia transcription NM_0252 factor 4 (PBX4), mRNA Homo sapiens solute carrier family 35, member NM_1735 F3 (SLC35F3), mRNA 08 Homo sapiens p21 (CDKN1A)-activated kinase NM_0025 3 (PAK3), mRNA 78 Homo sapiens neuritin 1 (NRN mRNA NM_0165 14.04 Down 13.92 Down 13.86 Down 2.40E-04 1 .43E-05 9.65E-04 13.83 Down 13.79 Down 6.53E-05 3.05E-05 13.77 Down 2.73 E-04 13.69 Down 13.61 Down 13.56 Down 3.06E-05 1.46E-04 6.51 24/05/06,15735 speci gp.281 -282- Homo sapiens lung type-I cell membrane- NM_1983 associated glycoprotein (T1A-2), transcript 89 variant 2, mRNA Homo sapiens ankyrin repeat domain 29 NM_1735 (ANKRD29), mRNA Homo sapiens RAS and EF hand domain NM_1525 containing (RASEF), mRNA 73 13.52 Down 13.38 Down 13.3 Down 13.11 Down 6.51 5.46E-05 4.40 E-04 5.06E-04 Homo sapiens chromosome 8 open reading frame 4 (CUorf4), mRNA NM_0201 N63415 yy6OdO4.sl Soares_multiple sclerosis_2NbHMSP Homo sapiens cDNA clone IMAGE:277927 3 similar to contains L1.b3 Li repetitive element;, mRNA sequence 13.03 Down 12.84 Down 12.7 Down 4.99E-04 3.91 E-04 2.28E-04 BX64820 7 Homo sapiens mRNA; cDNA DKFZp686E16168 (from clone DKFZp686E16168) Homo sapiens tubulin, beta polypeptide paralog NM_1780 (MGC8685), mRNA 12 Homo sapiens hypothetical protein MGC33993 NM_1527 (MGC33993), mRNA 37 qb95d06.xl Soares-fetal-heartNbHH19W A1126888 Homo sapiens cDNA clone IMAGE:1707851 3, mRNA sequence Homo sapiens HERV-H LTR-associating 1 NM_0057 (HHLA1), mRNA 12.61 Down 12.43 Down 12.39 Down 9.53E-06 4.50E-05 1 .42E-04 24/05/06.15735 speci gp.282 -283- Homo sapiens neuro-oncological ventral NM_0025 antigen 1 transcript variant 1, mRNA H23441 ym52fll1.s1 Soares infant brain 1iNIB Homo sapiens cDNA clone IMAGE:51 888 3, mRNA sequence Homo sapiens mRNA;, cDNA DKFZp434C1915 AL13769 (from clone DKFZp434C191 partial cds 8 Homo sapiens mRNA for KIAA0994 protein, A802321 partial cds 1 Homo sapiens mRNA full length insert cDNA AL38994 clone EUROIMAGE 2005635 12.32 Down 2.77 12.28 Down 3.96E-05 12.24 Down 5.21 12.15 Down 3.52E-05 12.03 Down 1 .88E-04 Homo sapiens mRNA full length insert cDNA AL35905 clone EUROIMAGE 592473 8 Homo sapiens hypothetical protein FLJ39553 NM_1735 (FLJ39553), mRNA 49 Homo sapiens fyn-related kinase (FRK), mRNA NM_0020 31 Homo sapiens mRNA for KIAA0523 protein, ABOl 109 partial cds Homo sapiens cytochrome P450, family 4, NM_1780 subfamily X, polypeptide 1 (CYP4X1), mRNA 33 11.96 Down 1.92E-05 11.93 Down 4.52E-05 11.64 Down 4.39E-05 11.59 Down 2.43E-05 11.58 Down 7.70E-05 Homo sapiens very low density lipoprotein 11.43 Down 1 .30E-04 24/05/06,15735 5peCi gp, 283 -284- INO INO NM_0033 receptor (VLDLR), mRNA 83 Homo sapiens cDNA FLJ43501 fis, clone AK12549 PEBLM2004497 11.25 Down 5.37E-04 Homo sapiens potassium inward ly-rectifying NM_0049 channel, subfamily J, member 8 (KCNJ8), 82 mRNA Homo sapiens paired related homeobox 2 NM_0163 (PRRX2), mRNA 07 Homo sapiens ankyrin repeat domain 7 NM_0196 (ANKRD7), mRNA 44 Homo sapiens mRNA; cDNA DKFZp434A2029 AL83414 (from clone DKFZp434A2029) 0 Homo sapiens glucosidase, beta (bile acid) 2 NM_0209 (GBA2), mRNA 11 Down 10.96 Down 10.92 Down 5.37E-05 9.84E-04 1.08E-04 10.85 Down 3.86E-04 10.85 Down 3.37E-04 CN47859 7 UI-CF-FNO-aeo-g-21-0-UI.sl UI-CF-FNO Homo sapiens cDNA clone UI-CF-FNO-aeo-g-21-0-UI 3, mRNA sequence RCO-CN0025-0 10200-01 2-dOl CN0025 Homo AW6034 sapiens cDNA, mRNA sequence 01 Homo sapiens cyclin-dependent kinase inhibitor NM_0000 1C (p57, Kip2) (CDKN1C), mRNA 76 qt94all1.xl NCICGAPCol4 Homo sapiens A1355761 cDNA clone IMAGE:1962908 3 similar to gb:X74929 KERATIN, TYPE 11 CYTOSKELETAL 8 (HUMAN);, mRNA 10.84 Down 10.78 Down 10.73 Down 3.83E-05 6.72E-04 1 .42E-04 10.63 Down 1.08E-04 24/05/06.15735 speci gp,29 4 285 sequence AW1729 03 xjO5eO4.xl NCICGAPUt2 Homo sapiens cDNA clone IMAGE:2656350 3, mRNA sequence Homo sapiens mRNA for keratin 19, partial cds, AB04126 isolate:K19-141 9 Homo sapiens, clone IMAGE:4794726, mRNA BC04202 8 Homo sapiens protein phosphatase 1, NM_0309 regulatory (inhibitor) subunit 14C (PPIP1R314C), 49 mRNA 10.58 Down 10.55 Down 10.53 Down 9.44E-05 1.35E-03 2.71 E-02 BX1 0347 6 BX1 03476 NCI_CGAP_Lu5 Homo sapiens cDNA clone IMAGp998C053946; IMAGE: 1557436, mRNA sequence Homo sapiens zinc finger protein 42 (ZFP42), NM_1749 mRNA 00 Homo sapiens hypothetical protein FLJ25378 NM_1527 (FLJ25378), mRNA 68 Homo sapiens solute carrier family 22 NM_0219 (extraneuronal monoamine transporter), 77 member 3 (SLC22A3), mRNA U--B14-apf-b-11-0-UI1.sl NCI_CGAP_Sub8 BF50957 Homo sapiens cDNA clone IMAGE:3086949 3, 3 mRNA sequence Homo sapiens mRNA; cDNA DKFZp686JO156 BX64896 (from clone DKFZp686JO1 56) 4 Homo sapiens limbic system-associated 10.51 Down 10.49 Down 10.38 Down 10.35 Down 10.27 Down 10.23 Down 10. 19 Down 10. 15 Down 2.17E-04 4.88E-02 1 .88E-04 8.16E-04 1 .97E-04 1.43E-05 6.44E-03 7.21 24/05/06,15735 speci gp,285 -286- NM_0023 membrane protein (LSAMP), mRNA 38 Homo sapiens CUG triplet repeat, RNA binding NM_0065 protein 2 (CUGBP2), mRNA 61 Homo sapiens cDNA FLJ41325 fis, clone AK12331 BRAMY2046871 9 Homo sapiens dehydrogenase/reductase (SDR NM_0047 family) member 3 (DHRS3), mRNA 53 601475864F1 NIH_MGC_68 Homo sapiens BE78876 cDNA clone IMAGE:3879014 5, mRNA 3 sequence Homo sapiens cytoplasmic polyadenylation NM_0305 element binding protein 1 (CPEB1), mRNA 94 Homo sapiens myxovirus (influenza virus) NM_0024 resistance 1, interferon-inducible protein p78 62 (mouse) (MX1), mRNA S69208 troponin T [human, skeletal and cardiac muscle, mRNA, 932 nt] Homo sapiens v-maf musculoaponeurotic NM_0053 fibrosarcoma oncogene homolog (avian) (MAF), mRNA Homo sapiens matrilin 2 (MATN2), transcript NM_0305 variant 2, mRNA 83 Homo sapiens tolloid-like 1 (TLL1), mRNA NM_0124 64 Homo sapiens growth factor receptor-bound 10.13 Down 1.75E-03 10.08 Down 3.96E-05 9.91 Down 9.88 Down 1.59E-03 3.14E-04 9.86 Down 9.8 Down 9.79 Down 9.76 Down 9.67 Down 9.66 Down 1.93E-03 3.75E-04 1.10E-03 9.46E-04 1.92E-05 1.76E-02 9.65 Down 8.22E-04 24/05/06,15735 speci gp,286 287 NM_0044 protein 14 (GRB14), mRNA Homo sapiens latrophilin 3 (LPHN3), mRNA NM_0152 36 Homo sapiens cDNA FLJ14199 fis, clone AK02426 NT2RP300271 3 9.65 Down 3.96E-05 9.62 Down 1 .63E-04 NM_2074 82 BM9691 9 1 Homo sapiens FLJ44048 protein (FLJ44048), mRNA UI-CF-ENO-acp-e-22-0-UI si U I-CF-ENO Homo sapiens cDNA clone UI-CF-EN0-acp-e-22-0-UI 3, mRNA sequence 9.49 Down 6. 53E-05 9.4 Down 9.34 Down 9.32 Down 2.21 E-04 5.78E-05 8.70E-05 M60502 Human profilaggrin mRNA, 3 end Homo sapiens B-factor, properdin mRNA NM_0017 Homo sapiens heparan sulfate (glucosamine) 3- NM_0051 0-sulfotransferase 1 (HS3ST1), mRNA 9.3 Down 1 .05E-04 Homo sapiens tyrosine kinase, non-receptor, 1 (TNK1I), mRNA 9.3 Down 1.OOE-04 NM_0039 Homo sapiens carboxypeptidase M (CPM), NM_001 8 transcript variant 1, mRNA 74 Homo sapiens chromosome 3 cDNA AJ69797 2 UI-E-CQ1 -aex-j06-0-U l.rl UI-E-CQ 1 Homo BM70198 sapiens cDNA clone UI-E-CQ1-aex-j06-0-UI 9.24 Down 9.15 Down 5.54E-04 3. 55E-04 9.09 Down 8.72E-03 24/05/06,15735 speci gp,2S7 -288- 9 mRNA sequence Homo sapiens mRNA; cDNA 9.09 Down 1.29E-04 BX64097 DKFZp686B15184 (from clone 3 DKFZp686B15184) Homo sapiens actin binding LIM protein 1 9.05 Down 1.23E-04 NM_0023 (ABLIM1), transcript variant 1, mRNA 13 DKFZp686J07250_ri 686 (synonym: hlcc3) 8.94 Down 9.28E-04 BX48620 Homo sapiens cDNA clone DKFZp686J07250 8 5, mRNA sequence Homo sapiens activating transcription factor 3 8.93 Down 9.73E-04 NM_0040 (ATF3), mRNA 24 S70348 Homo sapiens integrin beta 3 mRNA, partial 8.92 Down 6.01E-05 cds, alternatively spliced Homo sapiens CTAGE family, member 4 8.89 Down 1.28E-04 NM_1984 (CTAGE4), mRNA D86975 Homo sapiens mRNA for KIAA0222 gene, 8.88 Down 3.55E-04 partial cds Homo sapiens collagen, type XI, alpha 1 8.87 Down 6.78E-05 NM_0018 (COL11A1), transcript variant A, mRNA 54 Homo sapiens integrin, beta 3 (platelet 8.84 Down 7.53E-05 NM_0002 glycoprotein Ilia, antigen CD61) (ITGB3), 12 mRNA Homo sapiens mRNA; cDNA DKFZp434C128 8.8 Down 3.22E-04 AL11757 (from clone DKFZp434C128) 8 Homo sapiens transcription factor CP2-like 4 8.75 Down 8.93E-05 NM_1981 (TFCP2L4), transcript variant 3, mRNA 74 24/05/06,15735 speci gp.2 8 8 -289- UI-E-CRO-ach-e-1 2-0-UI si U I-E-CRO Homo 8.71 Down 5.91 E-04 BU72709 sapiens cDNA clone UI-E-CRO-ach-e-12-0-UI 3, 6 mRNA sequence Homo sapiens metallothionein 1iF (functional) 8.67 Down 3.29E-03 NM_0059 (MT1F), mRNA 49 Homo sapiens mRNA; cDNA 8.65 Down 7.70E-05 BX53761 DKFZp686E1 1117 (from clone 3 DKFZp686E1 1117) Homo sapiens C-type (calcium dependent, 8.57 Down 7.11 NM_0143 carbohydrate-recognition domain) lectin, 58 superfamily member 9 (CLECSF9), mRNA Homo sapiens glutamate decarboxylase 1 8.55 Down 2.77E-05 NM_0008 (brain, 67kDa) (GADII), transcript variant 17 GAD67, mRNA Homo sapiens noggin (NOG), mRNA 8.49 Down 2.75E-03 NM_0054 Homo sapiens prominin 2 (PROM2), mRNA 8.49 Down 2.72E-04 NM_1447 07 Homo sapiens mRNA for FLJ00254 protein 8.46 Down 7.83E-05 AK0741 8 1 Homo sapiens paraneoplastic antigen like 6A 8.44 Down 2.57E-05 NM_0328 (PNMA6A), mRNA 82 Homo sapiens fucosyltransferase 7 (alpha 8.39 Down 1.73E-05 NM_0044 fucosyltransferase) (FUT7), mRNA 79 Homo sapiens guanylate cyclase 1, soluble, 8.31 Down 1 .63E-04 NM_0008 alpha 3 (GUCY1A3), mRNA 24/05/06,15735 speci gp,289 290 56 Homo sapiens Mst3 and SOKi -related kinase 8.26 Down 6.03E-04 NM_0165 (MST4), mRNA 42 Homo sapiens desert hedgehog homolog 8.23 Down 6.01 E-04 NM_0210 (Drosophila) (DHH), mRNA 44 C1Homo sapiens protein S (alpha) (PROSI), 8.23 Down 4.08E-04 NM_0003 mRNA 13 Homo sapiens laminin, alpha 3 (LAMA3), 8.15 Down 2.89E-05 NM_0002 transcript variant 2, mRNA 27 ziO9fO9. s1 8.13 Down 4.99E-04 AA01061 Soares -fetal-liver-spleen 1NFLSSi Homo 1 sapiens cDNA clone IMAGE:430313 3, mRNA sequence Homo sapiens E74-like factor 3 (ets domain 8.07 Down 6.84E-05 NM_0044 transcription factor, epithelial-specific (ELF3), 33 mRNA Homo sapiens hydroxyprostaglandin 8.02 Down 1.49E-04 NM_0008 dehydrogenase 15-(NAD) (HPGD), mRNA RST27977 Athersys RAGE Library Homo 8 Down 2.90E-03 BG20847 sapiens cDNA, mRNA sequence N75271 yz74h12.rl 8 Down 3.67E-03 Soares_multiple sclerosis_2NbHMSP Homo sapiens cDNA clone IMAGE:288839 5, mRNA sequence Homo sapiens chromosome 2 open reading 8 Down 9.93E-05 NM_0229 frame 23 (C2orf 23), mRNA 24/05/06,15735 speci gp,290 -291 12 DKFZp686E1543_ri 686 (synonym: hlcc3) 7.98 Down 9.86E-05 AL70665 Homo sapiens cDNA clone DKFZp686E1 543 3 mRNA sequence zt65gll1.s1 Soares-testisNHT Homo sapiens 7.95 Down 9.11 AA41198 cDNA clone IMAGE:727268 3, mRNA 8 sequence Homo sapiens chromosome 21 open reading 7.95 Down 4.35E-05 NM_0201 frame 7 (C2lorf7), mRNA 52 Homo sapiens cDNA FLJ43620 fis, clone 7.93 Down 1 .87E-03 AK12560 SPLEN2021701, highly similar to HLA CLASS 1 8 HISTOCOMPATIBILITY ANTIGEN, A-2 ALPHA CHAIN PRECURSOR UI-H-FT1-bht-n-22-0-UI.s1 NCICGAPFT1 7.9 Down 7.95E-04 CA30688 Homo sapiens cDNA clone UI-H-FT1-bht-n-22- 1 0-UI 3, mRNA sequence wa27f0l.x1 NCICGAPKidli1 Homo sapiens 7.87 Down 3.33E-04 A1640484 cDNA clone IMAGE:2299321 3, mRNA sequence wj45h05.xl NCICGAPLu19 Homo sapiens 7.86 Down 5.42E-05 A1819863 cDNA clone IMAGE:2405817 3, mRNA sequence Homo sapiens cDNA FLJ42712 fis, clone 7.86 Down 2.13E-04 AK12470 BRAMY3008044 2 Homo sapiens immunoglobulin superfamily, 7.8 Down 5.41 E-03 NM_0143 member 4 (IGSF4), mRNA 33 H94320 yvl 8bl O.sl Soares fetal liver spleen 1iNELS 7.8 Down 4.43E-05 Homo sapiens cDNA clone IMAGE:243067 3, mRNA sequence 24/05/06,1 5735 speci gp. 29 1 292 Homo sapiens hypothetical zinc finger protein 7.77 Down 3.50E-04 NM_0221 FLJ14011 (FLJ14O11), mRNA 03 Homo sapiens transient receptor potential 7.75 Down 6.04 E-04 NM_0161 cation channel, subfamily C, member 4 79 (TRPC4), mRNA Homo sapiens IA-2 gene, intron 18 7.74 Down 1.92E-05 AF1 0809 3 Homo sapiens catenin (cadherin-associated 7.73 Down 5.06E-04 NM_001 3 protein), delta 2 (neural plakophilin-related arm- 32 repeat protein) (CTNND2), mRNA Homo sapiens integrin, alpha 7 (ITGA7), mRNA 7.73 Down 2.33E-03 NM_0022 06 UI-H-B14-apa-b-08-0-UI.sl NCICGAPSub8 7.68 Down 2.89E-05 BF51049 Homo sapiens cDNA clone IMAGE:3086558 3, 3 mRNA sequence in6OaO5.x3 HR85 islet Homo sapiens cDNA 7.63 Down 1 .74E-04 BU95146 clone IMAGE:6126249 3, mRNA sequence 9 wj32dlO.xl NCICGAPKid 12 Homo sapiens 7.62 Down 5.86E-04 A1819186 cDNA clone IMAGE:2404531 3, mRNA sequence Homo sapiens transgelin 3 (TAGLN3), 7.61 Down 3.22E-04 NM_0132 transcript variant 1, mRNA 59 wo8OcO6.xl NCICGAPKidi 1 Homo sapiens 7.57 Down 6.84E-05 A1942360 cDNA clone IMAGE:2461642 3, mRNA sequence BX098521 Soares fetal liver spleen 1 NFILS 7.55 Down 1.31 BX09852 Homo sapiens cDNA clone IMAGp998LO51 18; 24/05/06.t15735 speci gp. 292 293 1 IMAGE:123412, mRNA sequence Homo sapiens cornichon homolog 3 7.55 Down 5.20E-05 NM_1524 (Drosophila) (CNIH3), mRNA Homo sapiens myosin VC (MYO5C), mRNA 7.54 Down 1.30E-04 NM_0187 28 Homo sapiens coagulation factor C homolog, 7.51 Down 5.92E-04 NM_0040 cochlin (Limulus polyphemus) (COCH), mRNA 86 UI-E-EJ1-ajh-k-08-0-UI si UI-E-EJI Homo 7.48 Down 6.46E-05 BM68369 sapiens cDNA clone UI-E-EJ1-ajh-k-08-0-UI 3, 8 mRNA sequence Homo sapiens transporter 1, ATP-binding 7.47 Down 1.05E-04 NM_0005 cassette, sub-family B (MDRITAP) (TAPi), 93 mRNA Homo sapiens cDNA FLJ36973 fis, clone 7.44 Down 5.42E-05 AK09429 BRACE2006249 2 Homo sapiens transmembrane 4 superfamily 7.42 Down 1 .87E-03 NM_0314 member 10 (TM4SF1O), mRNA 42 Homo sapiens mRNA for FLJ00168 protein 7.41 Down 4.15E-04 AK07409 7 Homo sapiens G protein-coupled receptor 37 7.33 Down 1.15E-03 NM_0053 (endothelin receptor type B-like) (GPR37), 02 mRNA Homo sapiens multiple C2-domains with two 7.3 Down 5.46E-05 NM_0183 transmembrane regions 2 (MCTP2), mRNA 49 Homo sapiens transmembrane 4 superfamily 7.28 Down 7.73E-03 24/05/06, 15735 speci gp.293 -294- NM_0143 99 NM_0028 99 member 13 (TM4SF13), mRNA Homo sapiens retinol binding protein 1, cellular (RBP1), mRNA 7.28 Down 7.24 Down 1 .79E-03 5.84E-04 Homo sapiens olfactomedin-like 28 NM_0154 (OLFML-2B), mRNA 41 Homo sapiens citrate lyase beta like (CLYBL), NM_2068 transcript variant 2, mRNA 7.22 Down 9.35E-05 NM_2073 NM_0001 47 NM_0026 NM_0006 NM_0182 42 Homo sapiens FLJ43339 protein (FLJ43339), mRNA Homo sapiens fucosidase, alpha-L- 1, tissue (FUCAl), mRNA Homo sapiens plastin 1 (1 isoform) (PLSI), mRNA Homo sapiens nitric oxide synthase 1 (neuronal) (NOSi), mRNA Homo sapiens hypothetical protein FLJ10847 (FLJ10847), mRNA 7.19 Down 1.69E-03 7.17 Down 7.16 Down 7.15 Down 7.14 Down 7.11 Down 4.23E-02 2.28E-02 1 .46E-04 1 .48E-03 2.28E-02 N78460 yz76h06.rl Soares -multiple sclerosis_2NbHMSP Homo sapiens cDNA clone IMAGE:289019 5, mRNA sequence Homo sapiens troponin T2, cardiac (TNNT2), NM_001 0 transcript variant 2, mRNA 7.04 Down 9.11 24/05/06.15735 speci gp,294 295 01430 Homo sapiens G protein-coupled receptor, NM_0039 family C, group 5, member A (GPCR5A), mRNA 79 Homo sapiens TXK tyrosine kinase (TXK), NM_0033 mRNA 28 Homo sapiens cONA FLJ46882 fis, clone AK12871 UTERU3015844 Homo sapiens prostaglandin 12 (prostacyclin) NM_0009 synthase (PTGIS), mRNA 6.95 Down 6.94 Down 6.94 Down 4.47E-05 1 .44E-04 3.34E-03 6.91 Down 5.88E-04 Homo sapiens pannexin 2 (PANX2), mRNA 6.9 Down 7.48E-05 NM_0528 39 AR 1990 3 NM_0015 AW1 371 16 NM_0529 NM 0031 07 Homo sapiens PR02834 mRNA, complete cds Homo sapiens G protein-coupled receptor 30 (GPR3O), mRNA UI-H-B 1 -acp-f-03-0-U l.sl NCICGAPSub3 Homo sapiens cONA clone IMAGE:271 5029 3, mRNA sequence Homo sapiens retinol binding protein 7, cellular (RBP7), mRNA Homo sapiens SIRY (sex determining region Y)box 4 (SOX4), mRNA 6.89 Down 2.43E-05 6.84 Down 6.83 Down 6.79 Down 6.77 Down 1.15E-03 3.08E-05 3.15E-03 3.33E-04 Homo sapiens solute carrier family 1 6.77 Down 3.33E-04 24/05/06,15735 speci gp. 29 296 NM_0041 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 (SLC1A1), mRNA K-EST01 59876 L8SCKO Homo sapiens cDNA 6.75 Down 1 .69E-05 C131 1575 clone L8SCKO-8-H08 5, mRNA sequence CK1 4 Homo sapiens cDNA: FLJ23087 fis, clone 6.75 Down 1 .05E-04 AK02674 LNG06994, highly similar to AF 161368 Homo 0 sapiens HSPC105 mRNA Homo sapiens necdlin homolog (mouse) (NDN), 6.75 Down 6.29E-04 NM_0024 mRNA (Ni 87 M27161 Human MHC class I CD8 alpha-chain (Leu- 6.73 Down 4.96E-03 2/T8) gene, complete cds Homo sapiens cDNA:. FLJ21350 fis, clone 6.7 Down 4.15E-04 AK02500 C0L02751 3 Homo sapiens aldehyde dehydrogenase 1 6.69 Down 1.41 E-02 NM_0006 family, member A3 (ALDH 1A3), mRNA 93 Homo sapiens COBL-like 1 (COBLL1), mRNA 6.67 Down 1. 17E-02 NM_0149 00 602572521 Fl NIHMGC_77 Homo sapiens 6.66 Down 8.24E-04 BG54530 cDNA clone IMAGE:4700644 5, mRNA sequence Homo sapiens dickkopf homolog 2 (Xenopus 6.66 Down 2.17E-02 NM_0144 laevis) (DKK2), mRNA 21 Homo sapiens annexin A3 (ANXA3), mRNA 6.64 Down 2.04E-04 NM_0051 39 24105/06,15735 speci gp,296 297 BX1 11520 Soares placenta Nb2HP Homo 6.64 Down 7.70E-05 BX11152 sapiens cDNA clone IMAGp998L-15208; 0 IMAGE: 141470, mRNA sequence Homo sapiens cDNA FLJ33489 fis, clone 6.63 Down 1 .08E-04 AK09080 BRAMY2003585 8 D62831 HUM33OB12B Clontech human aorta polyA+ 6.58 Down 1.02E-03 mRNA (#6572) Homo sapiens cDNA clone GEN-330B12 5, mRNA sequence H18652 ym45e04.sl Soares infant brain INIB Homo 6.57 Down 1.OOE-03 sapiens cDNA clone IMAGE: 50948 3, mRNA sequence UI-H-EII-ayu-m-09-0-UI.sl NClCGAPEi 6.56 Down 1.26E-04 BQ00216 Homo sapiens cDNA clone IMAGE:5843888 3, mRNA sequence Homo sapiens armadillo repeat containing 4 6.54 Down 1.72E-04 NM_0180 (ARMC4), mRNA 76 H41942 yo6OaO8.rl Soares breast 3NbHBst Homo 6.53 Down 3.48E-03 sapiens cDNA clone IMAGE: 182294 5 similar to contains Alu repetitive element; contains LTR9 repetitive element;, mRNA sequence AJ318805 Homo sapiens adipose tissue Homo 6.5 Down 1.54E-04 AJ31880 sapiens cDNA clone 2040, mRNA sequence Homo sapiens cingulin-like 1 (CGNL1), mRNA 6.46 Down 1.84E-03 NM_0328 66 UI-H-DHO-arv-a-17-0-UI.sl NClCGAPDH0 6.44 Down 2.82E-04 CA43416 Homo sapiens cDNA clone UI-H-DHO-arv-a-1 7- 4 0-UI 3, mRNA sequence wsl 5dO4.xl NClCGAPKidli1 Homo sapiens 6.39 Down 2.77E-05 24/05/06,15735 spcci gp.2 97 298 AW0068 cDNA clone IMAGE:2497255 3, mRNA 64 sequence Homo sapiens neuroligin 1 (NLGN mRNA NM_0149 32 Homo sapiens mRNA; cDNA DKFZp686E1944 BX53822 (from clone DKFZp686E1 944) 6 Homo sapiens dapper homolog 1, antagonist of NM_0166 beta-catenin (xenopus) (DACTi), mRNA 51 Homo sapiens neurobeachin (NBEA), mRNA NM_0156 78 Homo sapiens CUB domain-containing protein NM_0228 1 (CDCP1), transcript variant 1, mRNA 42 Homo sapiens clone FLC0578 PR02852 AF13007 mRNA, complete cds 9 Homo sapiens mRNA; cDNA DKFZp566L2O3 ALl 1742 (from clone DKFZp566L203) Homo sapiens fibrinogen, B beta polypeptide NM_0051 (FGB), mRNA 41 6.39 Down 2.59 6.38 Down 1 .74E-04 6.38 Down 5.05E-04 6.34 Down 4.17E-03 6.32 Down 1.12 E-03 6.32 Down 1 .74E-02 6.29 Down 8.54E-05 6.28 Down 3.43E-04 AW5901 39 BE96859 6 hg33d12.xl NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2947415 3, mRNA sequence 601649770171 NIHMGC_74 Homo sapiens cDNA clone IMAGE:3933472 5, mRNA sequence 6.27 Down 6.26 Down 1.29E-04 6.39E-05 24/05106,15735 speci gp.298 299 Homo sapiens MOST2 mRNA, complete cds AF22026 3 Homo sapiens insulin-like growth factor 2 NM_0008 receptor (IGF2R), mRNA 76 Homo sapiens neuromedin U (NMU), mRNA NM_0066 81 Homo sapiens cONA: FLJ21212 fis, clone AK02486 C0L00502 6.25 Down 1.10E-03 6.25 Down 1.08E-03 6.25 Down 1.07E-04 6.24 Down 1 .05E-04 NM_0245 08 NM_1 779 49 NM_0012 57 NM_0012 00 Homo sapiens zinc finger, BED domain containing 2 (ZBED2), mRNA Homo sapiens armadillo repeat containing, Xlinked 2 (ARMCX2), mRNA Homo sapiens cadherin 13, H-cadherin (heart) (CDH 13), mRNA Homo sapiens bone morphogenetic protein 2 (BMP2), mRNA 6.22 Down 8.82E-04 6.18 Down 6.17 Down 6.15 Down 6.15 Down 1 .20E-02 8.46E-03 3.33E-04 6.53E-05 Homo sapiens cDNA FLJ43707 fis, clone AK12569 TES0P2001865 Homo sapiens, clone IMAGE:4822266, mRNA BC03356 7 Homo sapiens mRNA for MEGF6 protein AB01 153 (KIAAO815), partial cds 6.14 Down 3.14E-04 6.14 Down 1 .49E-03 24/05/06,15735 speci gp.299 -300- 9 Homo sapiens hypothetical protein FLJ22419 6.13 Down 2.72E-04 NM_0246 (FLJ22419), mRNA 97 Homo sapiens cDNA clone IMAGE:5736259, 6.13 Down 1.89E-03 BC04070 partial cds 1 Homo sapiens crystallin, zeta (quinone 6.12 Down 1.97E-02 NM_0018 reductase) (CRYZ), mRNA 89 BX108092 Soares-testisNHT Homo sapiens 6.08 Down 1.01 E-04 BX1 0809 cDNA clone IMAGp998I164460; 2 IMAGE: 1754967, mRNA sequence T65315 yc79h02.sl Soares infant brain 1iNIB Homo 6.08 Down 1.52E-04 sapiens cDNA clone IMAGE:22228 3, mRNA sequence BX09581 1 Soares-testisNHT Homo sapiens 6.07 Down 1 .68E-04 BX09581 cDNA clone IMAGp998E084494;- 1 IMAGE:1837423, mRNA sequence Homo sapiens glutaminyl-peptide 6.07 Down 4.25E-02 NM_0124 cyclotransferase (glutaminyl cyclase) (QPCT), 13 mRNA ta48dlO.x2 NCICGAPLu25 Homo sapiens 6.07 Down 4.15E-04 A1311296 cDNA clone IMAGE:2047315 3, mRNA sequence Homo sapiens chromosome 7 open reading 6.06 Down 1. 54 E-04 NM_1388 frame 31 (C7orf3l), mRNA 11 UI-H-DHO-arx-p-21-0-UI.sl NCICGAPDHO 6.05 Down 1.28E-04 BM98864 Homo sapiens cDNA clone IMAGE:5855492 3, 2 mRNA sequence Homo sapiens hypothetical protein 6.04 Down 1.25E-02 24/05/06,15735 speci gp,300 301 NM_0166 DKFZp434LI42 (DKFZp434L142), mRNA 13 W20132 zb4OclO.rl Soares-parathyroid-tumorNbHPA 6.01 Down 7.83E-05 Homo sapiens cDNA clone IMAGE:306066 mRNA sequence Homo sapiens cytidine deaminase (CDA), 6.01 Down 1.16E-04 NM_0017 mRNA Homo sapiens RABIl1 family interacting protein 6 Down 1.76E-02 NM_0251 1 (class 1) (RABi 1 FIPi), transcript variant 1, 51 mRNA Homo sapiens noncoding mRNA sequence 5.98 Down 1.26E-04 AF51 962 2 Homo sapiens Snf7 homologue associated with 5.97 Down 7.70E-05 NM_1522 Alix 3 (Shax3), mRNA 84 D29453 HUMNK566 Human epidermal keratinocyte 5.97 Down 3.58E-04 Homo sapiens cDNA clone 566, mRNA sequence qg84dOl xl SoaresNFLTGBCSi Homo 5.96 Down 9.78E-04 A1220066 sapiens cDNA clone IMAGE: 1841857 3, mRNA sequence Homo sapiens cDNA: FLJ22582 fis, clone 5.94 Down 1.10E-03 AK02623 HS102576 BX1 02869 Soares fetal liver spleen I1NFLS 5.92 Down 2.81 E-04 BX1 0286 Homo sapiens cDNA clone IMAGp998P1 7421 9 IMAGE:214528, mRNA sequence Homo sapiens tumor-associated calcium signal 5.92 Down 6.65E-04 NM_0023 transducer 1 (TACSTD1), mRNA 54 24/05/06,15735 spcci gp,301 302 UI-CF-FNO Homo 5.91 Down 1. 51 E-04 CA31309 sapiens cDNA clone UI-CF-FNO-aex-f-01-O-UI 3, mRNA sequence Homo sapiens mRNA; cDNA DKFZp686G2469 5.9 Down 1.07E-04 BX641 08 (from clone DKFZp686G2469) 6 Homo sapiens cDNA FLJ1 1431 fis, clone 5.88 Down 2.79E-04 AK02149 HEMBA1001094 3 Homo sapiens hypothetical protein MGC45474 5.87 Down 4.40E-04 NM_1523 (MGC45474), mRNA 69 L07615 Human neuropeptide Y receptor Y1 (NPYYI) 5.87 Down 3.91 E-04 mRNA, exon 2-3 and complete cds DKFZp686MO2112_si 686 (synonym: hlcc3) 5.84 Down 2.17E-04 BX50369 Homo sapiens cDNA clone DKFZp686MO21 12 4 3, mRNA sequence Homo sapiens claudin 1 (CLONi), mRNA 5.82 Down 1.24E-04 NM_0211 01 Homo sapiens ADP-ribosylation factor-like 7 5.8 Down 3.58E-04 NM_0057 (ARL7), mRNA 37 Homo sapiens GDNF family receptor alpha 1 5.8 Down 4.54E-05 NM_0052 (GFRA1), transcript variant 1, mRNA 64 Homo sapiens mRNA for KIAA0833 protein, 5.79 Down 7.11 AB02064 partial cds 0 Homo sapiens cDNA FLJ 12536 fis, clone 5.78 Down 2.20E-04 AK02259 NT2RM4000265 8 24/05106,15735 speci gp. 3 0 2 -303- Q Homo sapiens hypothetical protein FLJ33718 5.76 Down 2.95E-04 O NM 1736 (FLJ33718), mRNA Homo sapiens zinc finger protein 452 5.71 Down 3.90E-03 Ir NM_0529 (ZNF452), mRNA 23 Homo sapiens dopamine receptor D4 (DRD4), 5.71 Down 4.44E-03 NM_0007 mRNA 97 NO Homo sapiens netrin G1 (NTNG1), mRNA 5.7 Down 2.50E-04 NM_0149 N 17 Homo sapiens UDP glycosyltransferase 2 5.7 Down 9.11E-05 NM_0530 family, polypeptide B28 (UGT2B28), mRNA 39 Homo sapiens ral guanine nucleotide 5.68 Down 9.21E-03 NM_0062 dissociation stimulator (RALGDS), mRNA 66 Homo sapiens toll-like receptor 2 (TLR2), 5.67 Down 1.51E-04 NM_0032 mRNA 64 ze37c10.s1 Soares retina N2b4HR Homo 5.66 Down 1.17E-04 AA01703 sapiens cDNA clone IMAGE:361170 3 similar to contains Alu repetitive element;contains element MER37 repetitive element;, mRNA sequence Homo sapiens SMAD, mothers against DPP 5.65 Down 3.84E-02 NM_0059 homolog 2 (Drosophila) (SMAD2), transcript 01 variant 1, mRNA Homo sapiens interleukin 1, beta (IL1B), mRNA 5.64 Down 6.69E-05 NM_0005 76 24/05/06,15735 speci gp.303 304 Homo sapiens sorting nexin 10 (SNX10), 5.63 Down 4.81 E-04 NM_0133 mRNA 22 Homo sapiens partial mRNA for keratin 5.62 Down 5.80E-05 AJ40694 associated protein 4.9 (KRTAP4.9 gene) (Ni 1 Homo sapiens interleukin 18 (interferon- 5.61 Down 5.82E-03 NM_0015 gamma-inducing factor) (11-18), mRNA 62 NOHomo sapiens abhydrolase domain containing 5.59 Down 1.18E-04 NM_1735 7 (ABHD7), mRNA 67 F36108 HSPD33448 HM3 Homo sapiens cDNA clone 5.57 Down 7.05E-04 sH4-000003-1/E09, mRNA sequence Homo sapiens ankyrin repeat and BTB (POZ) 5.56 Down 1.76E-03 NM_1458 domain containing 2 (ABTB2), mRNA 04 UI-H-EI1-ayw-k-24-0-UI.sl NCICGAPEli 5.56 Down 1.46E-04 8000246 Homo sapiens cDNA clone IMAGE:5844623 3, 6 mRNA sequence Homo sapiens hypothetical protein L0C285533 5.56 Down 3.01 E-04 NM_1736 (L0C285533), mRNA 62 Homo sapiens coagulation factor XIII, Al 5.53 Down 1 .05E-04 NM_0001 polypeptide (F1 3A1), mRNA 29 Homo sapiens interleukin 8 mRNA 5.51 Down 1.82E-03 NM_0005 84 UI-E-CL1-afa-p-05-0-UI.sl UI-E-CL1 Homo 5.5 Down 6.13E-04 BM66444 sapiens cDNA clone UI-E-CL1-afa-p-05-0-UI 3, mRNA sequence 24/05/06,15735 speci gp,304 305 Homo sapiens leukocyte immunoglobulin-like 5.48 Down 3.09E-03 NM_0068 receptor, subfamily A (with TM domain), 63 member 1 (LILRA1), mRNA Homo sapiens microphthalmia-associated 5.46 Down 5.71 E-03 NM_0067 transcription factor (MITF), transcript variant 3, 22 mRNA Homo sapiens, clone IMAGE:2960615, mRNA 5.46 Down 3.64E-04 BC0331 2 4 Homo sapiens sortilin-related VPS10 domain 5.46 Down 1.26E-04 NM_0149 containing receptor 3 (SORCS3), mRNA 78 Homo sapiens clone 23738 mRNA sequence 5.46 Down 2.05E-04 AF00714 3 Homo sapiens ATP-binding cassette, sub-family 5.46 Down 4.75E-05 NM_0010 A (ABC1), member 3 (ABCA3), mRNA 89 Homo sapiens lethal giant larvae homolog 2 5.46 Down 2.73E-04 NM_0045 (Drosophila) (LLGL2), mRNA 24 xl92h06.xl NCICGAPUti Homo sapiens 5.45 Down 1 .29E-04 AW5914 cDNA clone IMAGE:2682203 3, mRNA 61 sequence Homo sapiens HERV-H LTR-associating 2 5.45 Down 1.18E-03 NM_0070 (HHLA2), mRNA 72 Homo sapiens hypothetical protein L0C253982 5.44 Down 6.64E-03 NM_1817 (L0C253982), mRNA 18 tq42hOl.xl NCICGAPUti Homo sapiens 5.44 Down 2.64E-03 A1559193 cDNA clone IMAGE:2211505 3, mRNA 24/05/06.15735 speci gp,305 -306sequence 7k31b04.x1 NCI_CGAP_Ov18 Homo sapiens 5.43 Down 4.72E-03 BF05847 cDNA clone IMAGE:3477054 3 similar to 1 contains element MER17 repetitive element;, mRNA sequence Homo sapiens cDNA FLJ26671 fis, clone 5.42 Down 4.50E-05 AK13018 MPG03325 1 Homo sapiens Rab6-interacting protein 2 5.41 Down 9.73E-04 NM_1780 (ELKS), transcript variant delta, mRNA 39 Homo sapiens spermine oxidase (SMOX), 5.4 Down 1.11E-02 NM_0190 transcript variant 5, mRNA BX108809 Soares fetal liver spleen 1 NFLS 5.4 Down 4.43E-02 BX10880 Homo sapiens cDNA clone IMAGp998L05373; 9 IMAGE:195988, mRNA sequence Homo sapiens hypothetical protein FLJ11267 5.4 Down 1.76E-02 NM_0196 (FLJ11267), mRNA 07 Homo sapiens disabled homolog 2, mitogen- 5.39 Down 3.11E-03 NM_0013 responsive phosphoprotein (Drosophila) 43 (DAB2), mRNA Homo sapiens cyclic nucleotide gated channel 5.34 Down 6.52E-04 NM_0000 alpha 1 (CNGA1), mRNA 87 Homo sapiens ferritin, heavy polypeptide-like 17 5.34 Down 4.47E-03 NM_0318 (FTHL17), mRNA 94 Homo sapiens nuclear factor of kappa light 5.33 Down 7.27E-03 NM_0314 polypeptide gene enhancer in B-cells inhibitor, 19 zeta (NFKBIZ), transcript variant 1, mRNA 24/05/06,15735 speci gp, 306 307 NORST18780 Athersys RAGE Library Homo 5.3 Down 4.14E-04 BG19949 sapiens cDNA, mRNA sequence 6 Homo sapiens eukaryotic translation elongation 5.29 Down 1 .97E-04 NM_0019 factor 1 alpha 2 (EEFIIA2), mRNA 58 Homo sapiens cellular retinoic acid binding 5.29 Down 5.17E-04 NM_0018 protein 2 (CRABP2), mRNA 78 UI-H-BIO-aaj-a-05-0-UI.sl NCICGAPSubi 5.29 Down 9.98E-04 AW0141 Homo sapiens cDNA clone IMAGE:2709393 3, 26 mRNA sequence Homo sapiens chemokine (C-C motif) ligand 26 5.28 Down 5.45E-03 NM_0060 (CCL26), mRNA 72 X70287 H.sapiens gene for thioredoxin, exons 2 and 3 5.27 Down 2.75E-02 Homo sapiens KIAA0711 gene product 5.27 Down 1.44E-03 NM_0148 (KIAAO711), mRNA 67 BX100098 Soares_pregnant uterusNbHPU 5.26 Down 2.59E-04 BX10009 Homo sapiens cDNA clone IMAGp998C021198 8 ;IMAGE:502201, mRNA sequence Homo sapiens cDNA FLJ30772 fis, clone 5.24 Down 8.92E-04 AK05533 FEBRA2000757, moderately similar to Homo 4 sapiens BM-009 mRNA AGENCOURT_10398872 NIHMGC_82 Homo 5.24 Down 2.28E-02 BU56780 sapiens cDNA clone IMAGE:6614502 5, mRNA 4 sequence Homo sapiens interferon, gamma-inducible 5.24 Down 1.75E-03 NM_0063 protein 30 (IF130), mRNA 32 24/05/06,15735 speci gp.307 308 7138d07.xl 5.23 Down 4.43E-05 BF1 1190 SoaresNSFF8_9WOTPAPSI Homo 3 sapiens cDNA clone IMAGE:3523644 3, mRNA sequence Homo sapiens cadherin 10, type 2 (T2- 5.2 Down 1.84E-04 NM_0067 cadherin) (CDH 10), mRNA 27 Homo sapiens tumor necrosis factor (ligand) 5.19 Down 2.91 E-03 NM_0038 superfamily, member 10 (TNFSF1Q), mRNA Homo sapiens cDNA FLJ45513 fis, clone 5.18 Down 8.OOE-05 AK12742 BRTHA2021450 1 Homo sapiens progestin and adipoQ receptor 5.18 Down 2.69E-05 NM_0248 family member VI (PAQR6), transcript variant 1, 97 mRNA UI-E-CK1-afh-h-18-0-UI.sl UI-E-CK1 Homo 5.17 Down 1.52E-04 BU72978 sapiens cDNA clone UI-E-CK1-afh-h-18-0-UI 3, 3 mRNA sequence BX107838 NOICGAPLu5 Homo sapiens 5.16 Down 4.26E-04 BX10783 cDNA clone IMAGp998A1 53853 8 IMAGE: 1521686, mRNA sequence Homo sapiens bone marrow stromal cell 5.16 Down 7.11 NM_0043 antigen 2 (BST2), mRNA Homo sapiens cDNA FLJ1 1575 fis, clone 5.15 Down 6.53E-05 AK02163 HEMBA1003531 7 Homo sapiens downregulated in ovarian cancer 5.15 Down 9.70E-05 NM_0148 1 (DOC1), transcript variant 2, mRNA Homo sapiens TGFB inducible early growth 5.14 Down 1.19E-03 24/05/06,1573 5 speci gp, 3 O 8 -309- NM_0035 response 2 (TIEG2), mRNA 97 wa86a12.xl SoaresNFLTGBCSi Homo 5.13 Down 9.14E-04 A1684824 sapiens cONA clone IMAGE:2303038 3, mRNA sequence Homo sapiens neuronal pentraxin I (NPTX1), 5.12 Down 1.52E-03 NM_0025 mRNA 22 Homo sapiens potassium intermediate/small 5.12 Down 1.28E-04 NM_0022 conductance calcium-activated channel, subfamily N, member 4 (KCNN4), mRNA Homo sapiens claudin 4 (CLDN4), mRNA 5.11 Down 3.26E-03 NM_0013 Homo sapiens, Similar to otoconin 90, clone 5.1 Down 2.17E-04 BC01 510 IMAGE:4044247, mRNA 8 N51335 yzl~eO8.sl 5.1 Down 2.89E-05 Soares-multiple sclerosis_2NbHMSP Homo sapiens cDNA clone IMAGE:283 142 3, mRNA sequence Homo sapiens GATA binding protein 3 5.06 Down 3.85E-03 NM_0010 (GATA3), transcript variant 1, mRNA 02295 Homo sapiens fibronectin leucine rich 5.05 Down 5.04E-03 NM_0132 transmembrane protein 3 (FLRT3), transcript 81 variant 1, mRNA tu89b07.xl NCICGAPGas4 Homo sapiens 5.04 Down 4.25E-03 A1623139 cDNA clone IMAGE:2258197 3, mRNA sequence Homo sapiens interferon induced with helicase 5.04 Down 2.48E-03 NM_0221 C domain 1 (IFIHi), mRNA 24/05/06.15735 speci gp,309 -310- 68 Homo sapiens cDNA clone IMAGE:5265929, 5.02 Down 5.42 E-04 BC05172 partial cds 7 24/05/06,15735 speci gp, 3 -311 TABLE VII F: GENES THAT WERE DIFFERENTIALLY EXPRESSED AT LEAST 5 FOLD IN AF-I VERSUS AF-III CELLS Gene Gene Name Average Direction adj. p- Identifier fold value change in AF-I cells versus AF- III cells Homo sapiens unc-5 homolog D elegans) 331.21 Up 5.22E-06 NM_0808 (UNC5D), mRNA 72 Homo sapiens collagen, type III, alpha 1 310.82 Up 3.56E-06 NM_0000 (Ehlers-Danlos syndrome type IV, autosomal dominant) (COL3A1), mRNA Homo sapiens endothelial cell adhesion 262 Up 6.27E-06 NM_1389 molecule (ESAM), mRNA 61 Homo sapiens cDNA FLJ11469 fis, clone 205.55 Up 3.10E-06 AK02153 HEMBA1001658 1 Homo sapiens twist homolog 1 116.12 Up 2.29E-05 NM_0004 (acrocephalosyndactyly 3; Saethre-Chotzen 74 syndrome) (Drosophila) (TWIST1), mRNA BX089554 Soares placenta Nb2HP Homo 97.02 Up 3.10E-06 BX08955 sapiens cDNA clone IMAGp998P07210; 4 IMAGE:142326, mRNA sequence Homo sapiens hypothetical protein FLJ10159 88.82 Up 3.10E-06 NM_0180 (FLJ10159), mRNA 13 Homo sapiens hypothetical protein FLJ39155 86.73 Up 3.10E-06 NM 1827 24/05/06,15735 speci gp,31 -312- ID98 (FLJ39155), transcript variant 2, mRNA Homo sapiens cysteine and tyrosine-rich 1 85.9 Up 3.10E-06 NM_0529 (CYYR1), mRNA 54 V)Homo sapiens 5-hydroxytryptamine (serotonin) 74.02 Up 3.19E-06 (N NM_0008 receptor 2B (HTR2B), mRNA 67 (iHomo sapiens syntaxin binding protein 6 71.46 Up 8.25E-06 NM_0141 (amisyn) (STXBP6), mRNA 78 U83115 Human non-lens beta gamma-crystallin like 66.41 Up 8.66E-06 protein (AIMi) mRNA, partial cds UI-H-FH1-bfh-k-22-0-UI.sl NCICGAPFH1 66.03 Up 2.19E-06 CA42913 Homo sapiens cODNA clone UI-H-FH1-bfh-k-22- 0-UI 3, mRNA sequence UI-H-EI1-azd-p-06-0-Ul.sl NCI_CGAP_Ei 54.48 Up 1.35E-05 BQ00350 Homo sapiens cIDNA clone IMAGE:5847413 3, 1 mRNA sequence BX105152 Soares-testisNHT Homo sapiens 50.41 Up 5.6311-06 BX1 0515 cIDNA clone IMAGp998J212575; 2 IMAGE:1031156, mRNA sequence Homo sapiens nebulette (NEBL), transcript 50.35 Up 1 .43E-05 NM_0063 variant 1, mRNA 93 Homo sapiens epiregulin (EREG), mRNA 49.79 Up 6.21 E-06 NM_0014 32 am58g02.xl Johnston frontal cortex Homo 45.53 Up 3.19E-06 Al 124557 sapiens cDNA clone IMAGE: 1539794 3, mRNA sequence Homo sapiens hypothetical protein FLJ10970 44.54 Up 1.84E-05 NM_0182 (FLJ1O97O), mRNA 24/05/06,15735 spcci gp.312 -313 86 O.xl NCICGAPGC6 Homo sapiens 44.13 Up 3.20E-05 A1962169 cDNA clone IMAGE:2474226 3, mRNA sequence Homo sapiens vasoactive intestinal peptide 42.63 Up 1.22E-05 NM_0033 (VIP), transcript variant 1, mRNA 81 Homo sapiens chondroitin betal,4 N- 42.53 Up 2.67E-05 NM_0183 acetylgalactosaminyltransferase (ChGn), mRNA 71 Homo sapiens chromosome 18 open reading 41.33 Up 6.27E-06 NM_1 814 frame 1 (Cl 8orfl), transcript variant al, mRNA 81 UI-1-BBlp-aye-f-10-0-UI.sl NCICGAPP16 39.96 Up 3.1 OE-06 BQ02582 Homo sapiens cIDNA clone UI-1-BBlp-aye-f-10- 1 0-UI 3, mRNA sequence Homo sapiens sema domain, immunoglobulin 37.45 Up 3.17E-05 NM_1 527 domain short basic domain, secreted, 54 (semaphorin) 3D (SEMA3D), mRNA Homo sapiens regulator of G-protein signalling 36.89 Up 2.02E-05 NM_0029 16 (RGS16), mRNA 28 H85497 yv88b07.rl Soares melanocyte 2NbHM Homo 35.37 Up 8.96E-05 sapiens cODNA clone IMAGE:249781 5, mRNA sequence UI-H-BW1-anu-e-05-0-UI.sl NCICGAPSub7 34.85 Up 5.22E-06 BF51565 Homo sapiens cONA clone IMAGE:3083601 3, 7 mRNA sequence hw22f09.xl NCICGAPKidli1 Homo sapiens 34.39 Up 1.39E-05 BE46576 cIDNA clone IMAGE:3183689 3, mRNA 0 sequence Homo sapiens cODNA: FLJ23475 fis, clone 33.21 Up 4.37E-06 24/05/06,15735 speci gp,313 -314- AK02712 HS113659 8 Homo sapiens, clone IMAGE:4817707, mnRNA 32.1 Up 3.37E-05 BC04067 8 Homo sapiens cytochrome c oxidase subunit 30.71 Up 1.69E-05 NM_0018 Vlla polypeptide 1 (muscle) (COX7A1), mRNA 64 Homo sapiens cDNA FLJ39389 fis, clone 28.39 Up 8.85E-06 AK09670 PLACE600362 1 8 Homo sapiens G protein-coupled receptor 27.96 Up 1.34E-05 NM_0053 kinase 5 (GRK5), mRNA 08 UI-HF-BNO-ane-d-05-0-UI.rl NIHMGC_50 27.55 Up 2.39E-05 CF13754 Homo sapiens cDNA clone IMAGE:3092384 mRNA sequence Homo sapiens dachshund homolog 2 25.26 Up 5.22E-05 NM_0532 (Drosophila) (DACH2), mRNA 81 Homo sapiens nuclear factor I/A (INFIA), mRNA 23.76 Up 2.51 NM_0055 UI-E-EJ1-ajl-l-13-0-UI.sl UI-E-EJ1 Homo 23.64 Up 1.16E-05 BM68512 sapiens cDNA clone UI-E-EJ1-ajl-l-13-0-UI 3, 4 mRNA sequence Homo sapiens dynein, cytoplasmic, 23.55 Up 4.37E-06 NM_0044 intermediate polypeptide 1 (DINC1), mRNA 11 Homo sapiens RAS-like, estrogen-regulated, 23 Up 3.96E-06 NM_0329 growth inhibitor (RERG), mRNA 18 24/05/06,15735 speci gp, 3 1 4 -315 Homo sapiens left-right determination factor 1 22.48 Up 9.37E-06 NM_0209 (LEFTYl), mRNA N33310 yy 39 gl O.sl Soares melanocyte 2NbHM Homo 22.37 Up 1.57E-05 V) sapiens cONA clone IMAGE:273666 3, mRNA sequence UI-E-EJO-aho-m-22-0-UI.rl UI-E-EJO Homo 21.7 Up 8.98E-06 BM71346 sapiens cODNA clone UI-E-EJO-aho-m-22-0-UI mRNA sequence IDHomo sapiens cDNA FLJ37734 fis, clone 21.49 Up 2.37E-05 AK09505 BRHIP2020842 (Ni 3 Homo sapiens clDNA clone IMAGE:4075924, 20.91 Up 7.23E-04 BC01672 partial cds 2 Ul-H-B13-akc-g-11-0-Ul.sl NCI_CGAP_Sub5 20.04 Up 6.27E-06 AW4452 Homo sapiens cDNA clone IMAGE:2733908 3, 09 mRNA sequence owl 3g03.xl 19.56 Up 2.18E-05 A1032876 Soares_parathyroid-tumorNbHPA Homo sapiens cDNA clone IMAGE: 1646740 3, mRNA sequence 602413981 Fl NIHMGC_92 Homo sapiens 18.94 Up 9.37E-06 BG38932 cDNA clone IMAGE:4522269 5, mRNA 8 sequence Homo sapiens T-cell lymphoma breakpoint 18.74 Up 5.63E-06 NM_1 533 associated target 1 (TCBAl), mRNA BX089554 Soares placenta Nb2HP Homo 18.36 Up 1.12E-06 BX08955 sapiens cONA clone IMAGp998P07210; 4 IMAGE:142326, mRNA sequence Homo sapiens neuronal PAS domain protein 2 17.94 Up 2.19E-06 24/05/06,15735 spcci gp.315 -316- NM_0025 (NPAS2), mRNA 18 qt26g09.xl Soares_pregnant uterusNbHPU 17.68 Up 8.37E-06 A1342246 Homo sapiens cDNA clone IMAGE: 1949152 3, mRNA sequence Homo sapiens unc-5 homolog B elegans) 17.32 Up 1.99E-05 NM_1707 (UNC5B), mRNA 44 wv38h09.xl NCICGAPOviS8 Homo sapiens 17.24 Up 8.84E-05 A1951740 cDNA clone IMAGE:2531873 3, mRNA sequence Homo sapiens glutamine-fructose-6-phosphate 16.65 Up 8.86E-06 NM_0051 transaminase 2 (GFPT2), mRNA Homo sapiens leucine rich repeat 16.45 Up 2.72E-05 NM_0155 transmembrane neuronal 2 (LRRTM2), mRNA 64 Homo sapiens, clone IMAGE:6155889, mRNA 16.38 Up 3.10E-06 BC 04341 1 Homo sapiens nudix (nucleoside diphosphate 16.25 Up 1.45E-05 NM_1 531 linked moiety X)-type motif 10 83 mRNA Homo sapiens histone 1, Hid (HISTi H1D), 16.24 Up 4.43E-04 NM_0053 mRNA W93585 zd9SgOl.sl Soares-fetal-heartNbHH19W 16.22 Up 1.39E-05 Homo sapiens cODNA clone IMAGE:357264 3, mRNA sequence Homo sapiens protease, serine, 3 (mesotrypsin) 16.15 Up 3.20E-05 NM_0027 (PRSS3), mRNA 71 24105/06.15735 speci gp,316 -317- Homo sapiens ubiquinol-cytochrome c 16.09 Up 3.10OE-06 NM_0133 reductase complex (7.2 kD) (HSPCO51), 87 transcript variant 1, mRNA Homo sapiens collagen, type IX, alpha 3 15.86 Up 4.01 NM_0018 (COL9A3), mRNA 53 Homo sapiens KIAA0528 gene product 15.81 Up 5.11iE-05 NM_0148 (KIAM0528), mRNA 02 Homo sapiens clone HB-2 mRNA sequence 15.64 Up 2.71 AF21 607 7 tu35dO6.xl NCICGAPPr28 Homo sapiens 15.12 Up 5.07E-06 A1686652 cDNA clone IMAGE:2253035 3, mRNA sequence oz4OhO1.s1 SoaresNhHMPuSi Homo 14.96 Up 2.47E-05 A1086279 sapiens cDNA clone IMAGE: 1677841 3, mRNA sequence Homo sapiens angiopoietin 1 (ANGPT1), 14.38 Up 1.29E-05 NM_001 1 transcript variant 1, mRNA 46 Homo sapiens tribbles homolog 2 (Drosophila) 14.32 Up 6.48E-06 NM_0216 (TRIB2), mRNA 43 Homo sapiens KIAA1 576 protein (KIAA1 576), 14.14 Up 1.61 NM_0209 mRNA 27 W69644 zd45flO.rl Soares-fetal-heartNbHH19W 14.01 Up 1.22E-05 Homo sapiens cDNA clone IMAGE:343627 mRNA sequence Homo sapiens general transcription factor IIIC, 13.95 Up 1.41 NM_01 22 polypeptide 4, 9OkDa (GTF3C4), mRNA 24/05/06,15735 speci gp, 3 17 -318- 04 UI-E-CI1-afw-p-01-0-UI.sl UI-E-CI1 Homo 13.53 Up 8.04E-05 BM66392 sapiens clDNA clone UI-E-CI1-afw-p-01-0-UI 3, 8 mRNA sequence UI-E-EO1-aiy-a-22-0-UI.rl UI-E-EO1 Homo 13.51 Up 3.19E-06 BM72406 sapiens cODNA clone UI-E-EO1-aiy-a-22-0-UI 2 mRNA sequence H51050 yp84ell1.sl Soares fetal liver spleen 1iNELS 13.39 Up 1.94E-05 Homo sapiens clDNA clone IMAGE:194156 3, mRNA sequence BX1 11353 NCICGAPKid3 Homo sapiens 13.38 Up 3.92E-05 BX11135 cODNA clone IMAGp9980094576; 3 IMAGE: 1869152, mRNA sequence Homo sapiens ankylosis, progressive homolog 13.27 Up 3.33E-05 NM_0540 (mouse) (ANKH), mRNA 27 Homo sapiens SH3 domain containing ring 13.06 Up 2.23E-05 NM_1 525 finger 2 (SH3RF2), mRNA Homo sapiens cytokine induced protein 29 kDa 12.87 Up 5.63E-06 NM_0330 (CIP29), mRNA 82 zr47elO.rl SoaresNhHMPuSi Homo sapiens 12.47 Up 6.41 AA23264 cONA clone IMAGE:666570 5, mRNA 3 sequence BX103846 NClCGAPLu24 Homo sapiens 12.4 Up 1.39E-05 BX10384 clDNA clone IMAdp998F12581 1; 6 IMAGE:2342027, mRNA sequence Homo sapiens brain specific protein (CGI-38), 12.26 Up 2.71 NM_0161 mRNA wy76dll1.xl 12.04 Up 6.21 E-06 24tO5IO6,15735 spedi gp,31 8 -319- IND AW0437 SoaresNSFF8_9WOTPAPSi Homo 93 sapiens cODNA clone IMAGE:2554485 3 similar C~~1to contains element MER1 8 repetitive element;, mRNA sequence Homo sapiens PR domain containing 8 12.01 Up 5.32E-06 CI NM_0202 (PRDM8), mRNA 26 8X1 13590 Soares-fetal-heartNbHH1 9W 11.97 Up 3.09E-05 BX1 1359 Homo sapiens cODNA clone IMAGp998A14871 0 IMAGE:376597, mRNA sequence IND Homo sapiens cODNA FLJ45742 fis, clone 11.91 Up 7.34E-05 (NiAK12764 KIDNE2016327 4 Homo sapiens flavoprotein oxidoreductase 11.88 Up 1.87E-05 BC04636 MICAL3, mRNA (cDNA clone IMAGE:5737121), 4 with apparent retained intron neO8eO5.y5 NCI_CGAPCo3 Homo sapiens 11.79 Up 4.15E-03 A1821210 cDNA clone IMAGE:880640 5, mRNA sequence Homo sapiens cONA FLJ46426 fis, clone 11.76 Up 2.88E-04 AK1 2828 THYMU301 3897 8 Homo sapiens collagen, type IV, alpha 6 11.56 Up 2.05E-05 NM_0336 (COL4A6), transcript variant B, mRNA 41 Homo sapiens fibroblast activation protein, 11.54 Up 1 .40E-05 NM_0044 alpha (FAP), mRNA qe47a12.y5 Soares fetal lung_NbHL19W 11.41 Up 1.33E-03 A1792426 Homo sapiens cDNA clone IMAGE:1742110 similar to contains MER22.b3 MER18 repetitive element;, mRNA sequence 24/05/06,15735 speci gp,319 320 Homo sapiens hypothetical protein FLJ 11273 11.23 Up 3.24E-04 NM_01 83 (FLA11273), mRNA 74 AGENCOURT_6457446 NIHMGC_88 Homo 11.11 Up 8.59E-05 BM80292 sapiens cDNA clone IMAGE:5560288 5, mRNA 0 sequence zk49f07.sl Soarespregnant-uterusNbHPU 11.1 Up 2.64E-05 AA04325 Homo sapiens cONA clone IMAGE:486181 3, mRNA sequence Homo sapiens collagen, type IV, alpha 6 10.98 Up 9.89E-06 NM_001 8 (COL4A6), transcript variant A, mRNA 47 Homo sapiens cIDNA FLJ42788 fis, clone 10.95 Up 9.27E-05 AK12477 BRAWH3007129 8 Homo sapiens cODNA FLJ26796 fis, clone 10.86 Up 1.02E-04 AK13030 PRS05079 6 Homo sapiens cONA FLJ 13677 fis, clone 10.83 Up 6.24E-05 AK02373 PLACE101 1982 9 Homo sapiens mRNA; cIDNA DKFZp451BO818 10.8 Up 5.63E-06 AL83262 (from clone DKFZp45I B0818) 4 Homo sapiens, Similar to arylacetamide 10.68 Up 2.37E-05 BC01434 deacetylase, clone IMAGE:3934567, mRNA 4 Homo sapiens prostaglandin E receptor 1 10.66 Up 1.14E-05 NM_0009 (subtype EPi), 42kDa (PTGER1), mRNA C24131 subtracted cochlea clDNA library Homo 10.47 Up 7.71 E-06 CD001 96 sapiens cDNA, mRNA sequence 24/05/06,15735 speci gp.320 -321 Homo sapiens chromosome 21 open reading NM_0322 frame 56 (C2lorf56), mRNA 61 Homo sapiens, clone IMAGE:4730399, mRNA BC03600 4 Homo sapiens anterior gradient 2 homolog NM_0064 (Xenopus laevis) (AGR2), mRNA 08 Homo sapiens mRNA for KIAA1 384 protein, AB03780 partial cds 602268030F1 NIHMGC_81 Homo sapiens BF96478 cDNA clone IMAGE:4356246 5, mRNA 10.42 Up 4.73E-06 10.3 Up 3.06E-05 10.28 Up 4.23E-05 10.24 Up 8.03E-05 10.02 Up 1.41 sequence Homo sapiens prostag land in-endoperoxide NM_0009 synthase 2 (prostaglandin G/H synthase and 63 cyclooxygenase) (PTGS2), mRNA Homo sapiens cDNA FLJ35222 fis, clone AK09254 PROST2000835 1 Homo sapiens nidogen 2 (osteonidogen) NM_0073 (NID2), mRNA 61 Homo sapiens fibronectin leucine rich NM_0132 transmembrane protein 2 (FLRT2), mRNA 31 Homo sapiens phospholamban (PLN), mRNA NM_0026 67 Homo sapiens ovarian cancer related tumor 9.91 U p 5.63E-06 9.88 Up 4.65E-02 9.68 Up 5.30E-06 9.58 Up 1 .43E-05 9.55 Up 9.83E-04 9.51 Up 1. 11 E-03 24/05/06,15735 speci gp.321 -322- AF41444 marker CA125 mRNA, complete cds 2 Homo sapiens cDNA FLJ43464 fis, clone 9.48 Up 1. 1 5E-02 AK12545 OCBBF2036225 in3 W38393 zbl5cO7.rl Soares-fetal lung_NbHL19W 9.39 Up 5.52E-05 Homo sapiens cDNA clone IMAGE:302124 mRNA sequence Homo sapiens hypothetical protein MGC33607 9.29 Up 2.35E-05 NM_1527 (MGC33607), mRNA Homo sapiens cONA FLJ34412 fis, clone 9.07 Up 2.06E-05 AK091 73 HEART2002432 1 Homo sapiens cONA: FLJ22256 fis, clone 9.05 Up 4.45E-05 AK02590 HRC02860 9 062676 HUM313C12B Clontech human aorta polyA+ 9.02 Up 1.38E-03 mRNA (#6572) Homo sapiens cDNA clone GEN-313C12 5, mRNA sequence Homo sapiens cDNA FLJ26445 fis, clone 8.98 Up 8.52E-05 AM2995 KDN02608 R22189 yh26a02.sl Soares placenta Nb2HP Homo 8.94 Up 2.29E-05 sapiens cONA clone IMAGE:130826 3, mRNA sequence EST375135 MAGE resequences, MAGH Homo 8.9 Up 1.76E-04 AW9630 sapiens cDNA, mRNA sequence 62 wx22g05.xl NCICGAPKidi11 Homo sapiens 8.89 Up 1.35E-05 AW0445 cDNA clone IMAGE:2544440 3, mRNA 02 sequence 24/05/06,15735 spedi gp.322 I -323 Homo sapiens NADH dehydrogenase 8.88 Up 4.45E-05 NM_0142 (ubiquinone) 1 alpha subcomplex, 8, 19kDa 22 (NDUFA8), nuclear gene encoding mitochondrial protein, mRNA Homo sapiens cDNA FLJ42571 fis, clone 8.82 Up 8.86E-06 AK12456 BRACE3008036 2 Homo sapiens killer cell lectin-like receptor 8.75 Up 9.45E-05 NM_0022 subfamily C, member 3 (KLRC3), transcript 61 variant NKG2-E, mRNA Homo sapiens, clone IMAGE:3881549, mRNA 8.71 Up 1.61E-04 BC01290 0 R53688 yg84h04.rl Soares infant brain 1NIB Homo 8.49 Up 1.74E-05 sapiens cDNA clone IMAGE:40175 5, mRNA sequence Homo sapiens mRNA; cDNA DKFZp586N0121 8.47 Up 6.83E-05 AL13311 (from clone DKFZp586N0121) 8 Homo sapiens killer cell lectin-like receptor 8.44 Up 1.61 E-04 NM_0022 subfamily C, member 2 (KLRC2), mRNA Homo sapiens matrix metalloproteinase 1 8.34 Up 5.17E-04 NM_0024 (interstitial collagenase) (MMP1), mRNA 21 Homo sapiens hyaluronan synthase 2 (HAS2), 8.18 Up 2.35E-04 NM_0053 mRNA 28 Homo sapiens melanoma associated antigen 8.12 Up 6.31E-05 NM_1524 (mutated) 1-like 1 (MUM1L1), mRNA 23 Homo sapiens chromosome 1 open reading 8.05 Up 5.83E-05 24/05/06,15735 sped gp, 3 2 3 324 NM_0048 frame 38 (Clorf38), mRNA 48 Homo sapiens nestin (NES), mRNA 8.01 Up 8.50E-06 NM_0066 17 C02345 HUMGS0007544 Human adult (K.Okubo) 8 Up 3.09E-05 Homo sapiens cONA, mRNA sequence Homo sapiens matrix Gla protein (MGP), mRNA 7.97 Up 3.88E-05 NM_0009 00 N54656 yzO8hO5.rl 7.97 Up 4.17E-05 Soares-multiple sclerosis_2NbHMSP Homo sapiens cODNA clone IMAGE:282489 5, mRNA sequence Homo sapiens cONA FLJ38407 fis, clone 7.97 Up 1.84E-05 AK09572 FEBRA2008859 6 Homo sapiens cDNA clone IMAGE:2984900, 7.95 Up 2.18E-04 BC02746 containing frame-shift errors 1 Homo sapiens cDNA FLJ38742 fis, clone 7.91 U p 1.32E-05 AK09606 KIDNE2012009 1 Homo sapiens mitochondrial tumor suppressor 7.84 Up 1 .22E-05 NM_001 01 (MTUS1), nuclear gene encoding 01931 mitochondrial protein, transcript variant 4, mRNA Homo sapiens decorin (DCN), transcript variant 7.82 Up 6.70E-06 NM 1335 B, mRNA 04 Homo sapiens RRN3 RNA polymerase 1 7.76 Up 1.39E-05 NM_0184 transcription factor homolog (yeast) (RRN3), 24/05/06,15735 speci gp, 324 -325- 27 mRNA Homo sapiens tissue factor pathway inhibitor 2 7.73 Up 3.1 OE-06 NM_0065 (TFPI2), mRNA 28 17000600077294 GRNPREHEP Homo 7.63 Up 1.83E-05 CN371 16 sapiens cONA 5, mRNA sequence 8 wd78b01 xl NCICGAPLu24 Homo sapiens 7.61 U p 1.82E-05 A1911957 cONA clone IMAGE:2337673 3, mRNA sequence Homo sapiens chromosome 21 open reading 7.59 Up 9.08E-05 NM_0581 frame 63 (C21lorf63), mRNA 87 Homo sapiens Kruppel-like factor 4 (gut) 7.52 Up 1.43E-05 NM_0042 (KLF4), mRNA Homo sapiens mRNA; cONA DKFZp76210915 7.51 U p 6.70E-06 AL83291 (from clone DKFZp76210915) 6 602351269F1 NIHMGC_90 Homo sapiens 7.49 Up 1.43E-05 BG1 1801 cONA clone IMAGE:4446065 5, mRNA 9 sequence h176b02.xl NCICGAPKidl3 Homo sapiens 7.41 U p 1.38E-04 AW7702 cDNA clone IMAGE:3007083 3, mRNA 83 sequence T47612 ybl 5hO3.s1 Stratagene placenta (#937225) 7.35 Up 9.37E-06 Homo sapiens cONA clone IMAGE:71285 3, mRNA sequence UI-H-DT1-awc-h-03-0-UI.sl NCICGAPDT1 7.31 U p 2.23E-05 BM99830 Homo sapiens cDNA clone IMAGE:5887538 3, 3 mRNA sequence Homo sapiens cONA FLJ34729 fis, clone 7.26 Up 1.57E-05 24/05/06,15735 speci gp,325 326 AK09204 MESAN2006401 8 Homo sapiens mRNA; cODNA DKFZp686P0492 7.24 Up 2.71 BX64754 (from clone DKFZp686P0492) 1 owl 0e02.xl 7.16 Up 7.24E-06 A1033863 Soares parathyroid-tumorNbHPA Homo sapiens cDNA clone IMAGE: 1646426 3, mRNA sequence Homo sapiens serum deprivation response 7.16 Up 3.17E-05 NM_0046 (phosphatidylserine binding protein) (SIDPR), 57 mRNA 7p57c03.xl NCICGAPPr28 Homo sapiens 7.13 Up 1.37E-04 BF22264 cIDNA clone IMAGE:3649901 3, mRNA 0 sequence UI-H-FL1-bfx-d-1O-O-UI.sl NCICGAPFLi 7.11 Up 1.46E-05 BU62079 Homo sapiens cIDNA clone UI-H-FL1-bfx-d-1O- 3 0-UI 3, mRNA sequence zn26a04.sl Stratagene neuroepithelium 7.01 Up 4.89E-05 AA10255 NT2RAMI 937234 Homo sapiens cODNA clone 3 IMAGE:548526 3, mRNA sequence Homo sapiens MIDi interacting protein 1 6.96 Up 1.32E-04 NM_0212 (gastrulation specific G12-like (zebrafish)) 42 (MIDlI13i), mRNA NlSC-gcO8bQ2.xl NCICGAPCol7 Homo 6.94 Up 1.32E-04 CB04503 sapiens cIDNA clone IMAGE:321 7875 3, mRNA sequence Homo sapiens TBCI domain family, member 8 6.92 Up 7.24E-06 NM_0070 (with GRAM domain) (TBC1D8), mRNA 63 H25898 y155b10.rl Soares breast 3NbHBst Homo 6.91 U p 5.94E-04 sapiens cIDNA clone IMAGE:162139 5, mRNA 24/05/06,15735 speci gp,326 -327sequence Homo sapiens cDNA FLJ34018 fis, clone 6.89 Up 1.05E-04 AK091 33 FCBBF2002801 7 601486331 Fl NIHMGC_69 Homo sapiens 6.88 Up 2.25E-04 BE87776 cDNA clone IMAGE:3888943 5, mRNA 4 sequence xl NCICGAPGC6 Homo sapiens 6.73 Up 2.28E-05 BE50391 cDNA clone IMAGE:32 10000 3, mRNA 6 sequence Homo sapiens leucine rich repeat 6.69 Up 2.67E-05 NM_0249 transmembrane neuronal 4 (LRRTM4), mRNA 93 Homo sapiens nidogen 2 (osteonidogen) 6.65 Up 2.63E-04 NM_0073 (NID2), mRNA 61 Homo sapiens cDNA clone IMAGE:4672631, 6.65 Up 1 .35E-05 BC07014 containing frame-shift errors 7 Homo sapiens tumor protein p53 inducible 6.62 Up 1 .80E-04 BC04566 protein 11, mRNA (cDNA clone 6 IMAGE:5298525), containing frame-shift errors Homo sapiens chromosome 10 open reading 6.59 Up 3.69E-05 N M_0177 frame 26 (Cl1Oorf26), m RNA 87 ij94e04.xl Human insulinoma Homo sapiens 6.59 Up 1.39E-04 BQ26780 cONA clone IMAGE:5779278 3, mRNA 6 sequence Homo sapiens myopalladin (FLJ14437), mRNA 6.57 Up 1.43E-05 NM_0325 78 Homo sapiens cONA FLJ42709 fis, clone 6.55 Up 1 .67E-05 24105/06,15735 speci gp.327 328 AK1 2469 BRAMY3007350 9 Homo sapiens phosphodiesterase 3A, cGMP- 6.51 Up 3.13E-05 NM_0009 inhibited (PIDE3A), mRNA 21 NISC-gjO3aO9.yl NCICGAPPr28 Homo 6.47 Up 8.86E-06 CB0481 3 sapiens cDNA clone IMAGE:3270448 5, mRNA 4 sequence ir49c12.xl HR85 islet Homo sapiens cDNA 6.44 Up 3.85E-05 CA84359 clone IMAGE:6548544 3, mRNA sequence 2 Homo sapiens chromosome 14 open reading 6.42 Up 2.45E-04 NM_0246 frame 139 (Cl4orfl39), mRNA 33 Homo sapiens mRNA; cONA 6.41 U p 3.09E-05 BX64068 DKFZp686MO8112 (from clone DKFZp686MO8112) Homo sapiens protein phosphatase 1, 6.38 Up 1.22E-05 NM_0053 regulatory (inhibitor) subunit 3C (PPP1 R3C), 98 mRNA Homo sapiens endlothelin receptor type A 6.36 Up 3.08 NM_0019 (EDNRA), mRNA 57 Homo sapiens thrombospondin 4 (THBS4), 6.35 Up 2.71 NM_0032 mRNA 48 UI-E-EJ 1-ajx-a-20-0-UI. ri UI-E-EJ 1 Homo 6.28 Up 5.68E-03 BQ18875 sapiens cDNA clone UI-E-EJ1-ajx-a-20-0-Ul 8 mRNA sequence wh52c02.xl NCICGAPKidl11 Homo sapiens 6.28 Up 2.77E-05 A1830524 cDNA clone IMAGE:2384354 3, mRNA sequence 24/05/06,15735 speci gp,328 329 602779092F2 NCICGAPBrn67 Homo 6.28 Up 1.57E-05 BG81876 sapiens cIDNA clone IMAGE:4914502 5, mRNA 2 sequence Homo sapiens phospholipase A2, group IVA 6.26 Up 3.90E-04 NM_0244 (cytosolic, calcium-dependent) (PLA2G4A), mRNA Homo sapiens hypothetical protein MGC33365 6.25 Up 1.39E-05 NM_1735 (MGC33365), mRNA 52 UI-E-EJ1-aka-o-12-O-UI.rl UI-E-EJ1 Homo 6.25 Up 2.62E-05 BQ18970 sapiens cONA clone UI-E-EJ1-aka-o-12-0-UI 7 mRNA sequence Homo sapiens SET binding protein 1 6.21 U p 1.83E-03 NM_0155 (SETBP1), mRNA 59 Ti15720 IB1788 Infant brain, Bento Soares Homo 6.17 Up 2.02E-05 sapiens cDNA 3end, mRNA sequence UI-H-B12-agj-f-01-0-UI.sl NCI_CGAP_Sub4 6.15 Up 3.80E-05 AW291 0 Homo sapiens cIDNA clone IMAGE:2724601 3, 13 mRNA sequence Homo sapiens iroquois homeobox protein 3 6.12 Up 9.89E-06 NM_0243 (IRX3), mRNA 36 Homo sapiens myc target 1 (MYCTi), mRNA 6.11 Up 5.67E-05 NM_0251 07 Homo sapiens sestrin 3 (SESN3), mRNA 6.11 Up 1.39E-04 NM_1446 og77h08.sl NCI_CGAP_0v8 Homo sapiens 6.07 Up 2.25E-04 AA90881 cODNA clone IMAGE:1454367 3, mRNA sequence 24/05/06,15735 speci gp.329 330 Homo sapiens hypothetical protein FLJ12604 6.05 Up 2.61 E-04 NM_0246 (FLJ12604), mRNA 21 qt24d07.xl NCICGAPGC4 Homo sapiens 6.02 Up 8.66E-06 Al335546 cDNA clone IMAGE:1948525 3, mRNA sequence Homo sapiens mRNA, chromosome 1 specific 5.99 Up 5.46E-05 AB00795 transcript KIAA0485 4 Homo sapiens caspase 1, apoptosis-related 5.95 Up 4.51 NM_0332 cysteine protease (interleukin 1, beta, 92 convertase) (GASP transcript variant alpha, mRNA BX1 12737 Soares placenta Nb2HP Homo 5.94 Up 3.13E-06 BX1 1273 sapiens cDNA clone IMAGp998H 17189; 7 IMAGE:134080, mRNA sequence Homo sapiens v-ets erythroblastosis virus E26 5.94 Up 1.14E-04 NM_0052 oncogene homolog 2 (avian) (ETS2), mRNA 39 UI-E-EJO-aig-o-17-0-UI.sl UI-E-EJO Homo 5.91 U p 7.10E-05 BM67797 sapiens cDNA clone UI-E-EJO-aig-o-1 7-0-Ul 3, 8 mRNA sequence Homo sapiens mRNA; cDNA 5.91 U p 1. 15E-04 BX64860 DKFZp686M 11213 (from clone 4 DKFZp686M 11213) Homo sapiens, clone IMAGE:531 0819, mRNA 5.91 U p 4.16E-04 BC041 99 7 Homo sapiens similar to lymphocyte antigen 6 5.85 Up 5.37 NM_1452 complex, locus G513; G5b protein; open reading 39 frame 31 (L0C1 12476), mRNA Homo sapiens ral guanine nucleotide 5.85 Up 2.32E-05 24/05/06.15735 speci gp,330 -331 NM_0151 dissociation stimulator-like 1 (RGL1), mRNA 49 Homo sapiens transcription factor 7-like 2 5.85 Up 3.88E-05 NM_0307 cell specific, HMG-box) (TCF7L2), mRNA 56 UI-H-FG1-bgq-i-08-0-UI.sl NOICGAPFG1 5.85 Up 1.70E-04 BU62614 Homo sapiens cDNA clone UI-H-FG1-bgq-i-08- 4 0-UI 3, mRNA sequence AGENCOURT_6544282 NIHMGC_88 Homo 5.83 Up 1.85E-05 BM55619 sapiens cDNA clone IMAGE:5550173 5, mRNA 1sequence U l-E-EJ 1-ajk-n-1 9-0-UI.rl UI-E-EJ Homo 5.81 U p 2.62E-05 BM93186 sapiens cDNA clone UI-E-EJ1-ajk-n-19-0-UI 7 mRNA sequence 602595685171 NIHMGC_87 Homo sapiens 5.8 Up 7.12E-05 BG57644 cDNA clone IMAGE:4708725 5, mRNA 2 sequence Homo sapiens LOW11CRIA gene, loss of 5.78 Up 1.63E-03 AB09624 heterozygosity, 11, chromosomal region 1 gene 0 A product Homo sapiens syntaxin 16 (STX16), transcript 5.72 Up 7.02E-05 NM_0037 variant 2, mRNA 63 UI-1-BC1p-alg-a-03-0-UI.sl NOIOGAPP13 5.69 Up 1.22E-05 BQ01 386 Homo sapiens cDNA clone UI-1 -BC1 p-alg-a-03- 9 0-UI 3, mRNA sequence Homo sapiens calcitonin receptor-like 5.68 Up 3.82E-05 NM_0057 (CALCRL), mRNA UI-E-CK-abr-c-12-0-Ul.rl UI-E-CK1 Homo 5.64 Up 2.37E-05 BM69005 sapiens cONA clone UI-E-CK1 -abr-c-1 2-0-Ul 3 mRNA sequence 24/05/06,15735 speci gp.33 I 332 Homo sapiens mRNA; cODNA DKFZp686H157 5.64 Up 7.39E-06 AL83277 (from clone DKFZp686H157) 9 UI-H-DFO-bel-l-04-0-UI.sl NCICGAPDFO 5.63 Up 2.47E-05 CA42535 Homo sapiens cODNA clone UI-H-DFO-bel-l-04- 0 0-UI 3, mRNA sequence zt74e03.sl Soares-testisNHT Homo sapiens 5.62 Up 1.87E-04 AA39862 cONA clone IMAGE:728092 3, mRNA 8 sequence BX093329 Soaresparathyroid-tumorNbHPA 5.61 U p 7.11 BX09332 Homo sapiens clDNA clone IMAGp998A124183 9 IMAGE: 1648403, mRNA sequence Homo sapiens tumor necrosis factor (ligand) 5.58 Up 1 .02E-05 NM_0065 superfamily, member 13b (TNFSF13B), mRNA 73 Homo sapiens cODNA FLJ42709 fis, clone 5.53 Up 1.72E-04 AK1 2469 BRAMY3007350 9 DKFZp686M125_ri 686 (synonym: hlcc3) 5.53 Up 1.80E-04 AL70960 Homo sapiens cODNA clone DKFZp686M 125 6 mRNA sequence UI-1-BBlp-axt-g-01-0-Ul.sl NCICGAPP16 5.5 Up 2.79E-03 BQ02272 Homo sapiens cDNA clone UI1-1 -BBl1p-axt-g-01 1 0-UI 3, mRNA sequence nq22g06.sl NCICGAPColO0 Homo sapiens 5.47 Up 4.31 E-04 AA61357 clDNA clone IMAGE: 1144666 3, mRNA 2 sequence R38944 ydO6gO9.sl Soares infant brain 1INIB Homo 5.45 Up 4.34E-05 sapiens clDNA clone IMAGE:25061 3 similar to contains Alu repetitive element;, mRNA sequence Homo sapiens clDNA FLJ42572 fis, clone 5.43 Up 9.13E-06 24/05/06,15735 speci gp.332 333 AK12456 BRACE3008092 3 Homo sapiens cIDNA clone IMAGE:5284659, 5.42 Up 7.14E-04 BC03792 partial cds 9 Homo sapiens clDNA FLJ39217 fis, clone 5.41 U p 3.17E-06 AK09653 0CBBF2006639, moderately similar to ZINC 6 FINGER PROTEIN 84 Homo sapiens mRNA; cIDNA DKFZp586N2O2O 5.41 U p 2.83E-04 AL04944 (from clone DKFZp586N2O2O) 3 Homo sapiens Epstein-Barr virus induced gene 5.39 Up 4.33E-04 NM_0049 2 (lymphocyte-specific G protein-coupled 51 receptor) (EBI2), mRNA Homo sapiens cadherin 19, type 2 (CDH 19), 5.37 Up 3.26E-05 NM_0211 mRNA 53 BX106577 Soares_NhHMPu_Si Homo sapiens 5.37 Up 2.51 BX10657 cODNA clone IMAGp998H131854; 7 IMAGE:754236, mRNA sequence xf07g08.xl NCI_CGAP_Kid8 Homo sapiens 5.36 Up 2.78E-04 AW1489 cIDNA clone IMAGE:2617406 3, mRNA 79 sequence ov68h06.xl Soares-testisNHT Homo sapiens 5.35 Up 3.75E-05 A1024717 cIDNA clone IMAGE:1642523 3, mRNA sequence Homo sapiens clone 25194 mRNA sequence 5.34 Up 2.14E-05 AF1 3178 4 Homo sapiens clDNA FLJ35056 fis, clone 5.32 Up 6.05E-05 AK09237 OCBBF2018581 24/05/06,15735 speci gp,333 -334- Homo sapiens serine (or cysteine) proteinase 5.3 Up 1 .74E-04 NM_0026 inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1 (SERPINFi), mRNA Homo sapiens colon carcinoma related protein 5.3 Up 2.44E-04 NM_0162 (FLJ38507), mRNA 06 RC1-NT0033-250800-018-g09 NT0033 Homo 5.29 Up 4.05E-05 BQ34685 sapiens cDNA, mRNA sequence 7 Ul-1-BBlp-akc-h-10-0-UI.sl NCICGAPP16 5.29 Up 7.29E-04 BQ02617 Homo sapiens cIDNA clone UI-1 -B1331p-akc-h- 1 0-0-U 13, m RNA seq uence Homo sapiens DMVRT-like family B with proline- 5.28 Up 2.03E-04 NM_0330 rich C-terminal, 1 (DMRTB1), mRNA 67 Homo sapiens cONA FLJ45950 fis, clone 5.27 Up 6.27E-06 AK1 2784 PLACE70081 36 7 ov67g08.xl Soares-testisNHT Homo sapiens 5.27 Up 1.14E-04 A1024323 cONA clone IMAGE: 1642430 3, mRNA sequence Homo sapiens RNA binding motif protein 15 5.27 Up 3.30E-04 NM_0227 (RBM15), mRNA 68 Homo sapiens, clone IMAGE:4106389, mRNA 5.24 Up 2.73E-03 BC01 678 0 Ul-H-DFO-bey-f-20-0-UI.sl NCICGAPOFO 5.23 Up 2.60E-04 CA42717 Homo sapiens cDNA clone 0 0-UI 3, mRNA sequence Homo sapiens mRNA; cDNA DKFZp779M0552 5.23 Up 5.42E-05 24/05/06,15735 speci gp,334 335 BX53786 (from clone DKFZp779MO552) 2 Homo sapiens homeo box C8 (HOXC8), mRNA 5.22 Up 4.37E-04 NM_0226 58 601237381 F1 NIHMGC_44 Homo sapiens 5.21 U p 1.74E-04 BE37885 cDNA clone IMAGE:3609140 5, mRNA 2 sequence Homo sapiens mRNA for FLJO0204 protein 5.18 Up 5.59E-05 AK07413 1 BX098131 Soares-testisNHT Homo sapiens 5.15 Up 1.32E-05 BX09813 cONA clone IMAGp998O10183O; 1 IMAGE:745185, mRNA sequence we9lhl2.xl SoaresNFLTGBCSi Homo 5.14 Up 5.68E-04 A1798732 sapiens cONA clone IMAGE:2348519 3, mRNA sequence Homo sapiens hypothetical protein 5.13 Up 3.63E-04 NM_0175 DKFZp434C0328 (DKFZp434C0328), mRNA 77 Homo sapiens leucine-rich repeats and 5.12 Up 1.04E-04 NM_01 55 immunoglobulin-like domains 1 (LRIG1), mRNA 41 Homo sapiens ligand of numb-protein X (LNX), 5.12 Up 1.74E-04 NM_0326 mRNA 22 Homo sapiens acyl-Coenzyme A oxidase 2, 5.11 Up 1 .34E-05 NM_0035 branched chain (ACOX2), mRNA 00 Homo sapiens hypothetical protein FLJ34922 5.07 Up 4.93E-05 NM_1522 (FLJ34922), mRNA 24/05/06,15735 speci gp,335 -336- U I-E-CQI -aew-i-06-0-UI ri UI-E-CQ 1 Homo BM69562 sapiens cDNA clone UI-E-CQ1-aew-i-06-0-UI 6 mRNA sequence Homo sapiens tropomnodulin 2 (neuronal) NM_0145 (TMOD2), mRNA 48 Homo sapiens, clone IMAGE:5272183, mRNA BC03622 3 Homo sapiens chromosome 10 open reading NM_1735 frame 107 (ClOorflO07), mRNA 54 Homo sapiens hypothetical protein NM_0184 DKFZp76100113 (DKFZp76100113), mRNA 09 Ul-H-B14-aoz-c-06-0-Ul.sl NOICGAPSub8 BF50949 Homo sapiens cDNA clone IMAGE:3086579 3, 2 mRNA sequence UI-H-EZ1-baz-b-10-0-UI.sl NCICGAPCh2 BQ57434 Homo sapiens cDNA clone UI-H-EZ1 -baz-b-1 0- 4 0-UI 3, mRNA sequence Homo sapiens SRY (sex determining region Y)- NM_0224 box 17 (SOX17), mRNA 54 RST39494 Athersys RAGE Library Homo BG21972 sapiens cDNA, mRNA sequence 9 Homo sapiens hypothetical protein MGC33993 NM_1527 (MGC33993), mRNA 37 BX102632 NCICGAPCo3 Homo sapiens BX10263 cDNA clone IMAGp998J052307; 5.06 Up 5.05 Up 1.I1OE-03 4.23E-03 5.04 Up 6.69E-05 5.04 Up 8.63E-05 5.03 Up 5.01 Up 5.01 Up 3.39E-04 1 .99E-03 7.24E-06 366.7 Down 268.82 Down 3. 1OE-06 2.19E-06 250.88 Down 1.66E-06 188.6 Down 1 .29E-06 24/05/06.15735 speci gp,336 337 IMAGE:928228, mRNA sequence Homo sapiens natriuretic peptide precursor B NM_0025 (NPPB), mRNA 184.64 Down 160.77 Down 3.10E-06 Homo sapiens CD24 antigen (small cell lung carcinoma cluster 4 antigen) (CD24), mRNA 4.30E-06 NM_0132 Homo sapiens cDNA FLJ 13569 fis, clone AK02363 PLACE1 008369 154.91 Down 141.97 Down 5.78E-07 NM_0061 69 Homo sapiens nicotinamide Nmethyltransferase (NNMVT), mRNA Homo sapiens prepronociceptin (PNOC), mRNA 1.12 E-06 NM_0062 28 138.62 Down 130.91 Down 1 .22E-05 6.27E-06 wh56c02.xl NCICGAPKidi 1 Homo sapiens A1765021 cDNA clone IMAGE:2384738 3, mRNA sequence Homo sapiens transmembrane 4 superfamily NM_0046 member 4 (TM4SF4), mRNA 17 Homo sapiens cDNA FLJ39162 fis, clone AK09648 OCBBF2002376 1 Homo sapiens a disintegrin-like and NM_0070 metalloprotease (reprolysin type) with 38 thrombospondin type 1 motif, 5 (aggrecanase- 2) (ADAMTS5), mRNA Homo sapiens mRNA for KIAA1 154 protein, AB03298 partial cds 0 111.06 Down 1 .43E-05 102.43 Down 3.17E-06 95.94 Down 6.14E-06 85.12 Down 9.37E-06 24/05/06,15735 speci gp, 33 7 338 Homo sapiens cDNA FLJ34926 fis, clone AK09224 NT2RP700331 9, highly similar to Mus musculus neuralin mRNA Homo sapiens keratin 19 (KRT1 mRNA NM_0022 76 aj64a03.xl NCICGAPKid3 Homo sapiens A1249696 cDNA clone IMAGE: 1864204 3, mRNA 70.22 Down 59.59 Down 2.04E-05 2.19E-06 56.92 Down 9.37E-06 sequence D29453 HUMNK566 Human epidermal keratinocyte Homo sapiens cDNA clone 566, mRNA sequence Homo sapiens dehydrogenase/reductase (SDR NM_0047 family) member 3 (DHRS3), mRNA 53 Homo sapiens tolloid-like 1 (TLL1), mRNA NM_0124 64 Homo sapiens serine-arginine repressor protein NM_0807 (35 kDa) (SRrp35), mRNA 43 Homo sapiens forkhead box Al (FOXA1), NM_0044 mRNA 96 UI-H-BW1 -amf-c-08-0-UI sI NCIOGAPSub7 BF51254 Homo sapiens cDNA clone IMAGE:3069687 3, 4 mRNA sequence Homo sapiens doublecortin domain containing NM_0163 2 (DCDC2), mRNA 56 Homo sapiens leucine rich repeat neuronal 1 NM_0208 (LRRN1), mRNA 53.31 Down 50.19 Down 48.62 Down 5.14E-06 1.41 1.72E-04 48.46 Down 1.34E-06 47.75 Down 46.87 Down 46.71 Down 45.32 Down 3.10E-06 6.56E-06 1 .48E-05 3.17E-06 24/05/06,15735 speci bp,338 -339- Homo sapiens neuropilin (NRP) and tolloid NM_1 389 (TLL)-like 1 (NET0l), transcript variant 3, 66 mRNA Homo sapiens secreted phosphoprotein 1 NM_0005 (osteopontin, bone sialoprotein 1, early T- 82 lymphocyte activation 1) (SPP1), mRNA UI-CF-DUl1-aaz-f-04-0-UI si UI-CF-DU 1 Homo BU68066 sapiens cDNA clone UI-CF-DU 1-aaz-f-04-0-U I 1 3, mRNA sequence Homo sapiens tripartite motif-containing 55 NM_1 840 (TRIM55), transcript variant 4, mRNA 87 Homo sapiens natural killer cell transcript 4 NM_0042 (NK4), mRNA 21 UI-H-FEO-bbs-f-17-0-UI.sl NCICGAPFEO CA4161 0 Homo sapiens cDNA clone UI-H-FEO-bbs-f-1 7- 6 0-UI 3, mRNA sequence Homo sapiens mab-21 -like 2 elegans) NM_0064 (MAB21L2), mRNA 39 7o1 8c06.xl NCICGAPKidi 1 Homo sapiens BF43103 cDNA clone IMAGE:3574283 3, mRNA 0 sequence Homo sapiens Fraser syndrome 1 (FRASi), NM_0250 transcript variant 1, mRNA 74 RST16291 Athersys RAGE Library Homo BG19705 sapiens cDNA, mRNA sequence 4 44.78 Down 43.26 Down 43.24 Down 41.43 Down 40.53 Down 40.33 Down 40.02 Down 39.89 Down 39.81 Down 39.23 Down 1 .84E-05 9.71 E-06 3.19E-06 3.1 9E-06 1 .66E-05 2.77E-05 3.10QE-05 1.22E-05 3.82E-06 3.73E-05 602344592F1 NIHMGC_89 Homo sapiens 37.22 Down 1 .39E-04 24/05/06,15735 speci p339 -340- BG16574 cDNA clone IMAGE:4454470 5, mRNA sequence Homo sapiens neurotrophin 3 (NTF3), mRNA NM_0025 27 Homo sapiens potassium inward ly-rectifyi ng NM_0049 channel, subfamily J, member 8 (KCNJ8), 82 mRNA Homo sapiens chromosome 14 open reading NM_0181 frame 105 (Cl4orfl05), mRNA 68 34.83 Down 33.22 Down 5.63E-06 3.22E-05 BQ00340 BC03731 6 UI-H-EI1-azd-j-23-0-UI.sl NCICGAPEli Homo sapiens cDNA clone IMAGE:.5847286 3, mRNA sequence Homo sapiens, clone IMAGE:5259432, mRNA 31.87 Down 31.63 Down 30.99 Down 1 .84E-05 8.86E-06 2.19E-06 Homo sapiens TP53TG3 protein (TP53TG3), NM_0162 mRNA 12 QV2-TNO1 73-0211 00-454-g06 TNO1 73 Homo BQ37571 sapiens cDNA, mRNA sequence 9 Homo sapiens immunoglobulin superfamily, NM_0143 member 4 (IGSF4), mRNA 33 Homo sapiens HERV-H LTR-associating 1 NM_0057 (HHLAI), mRNA 30.74 Down 1 .57E-05 30.59 Down 1 .84E-05 30.19 Down 2.42E-05 29.97 Down 1 .62E-05 Homo sapiens endothelin 1 (EDNi), mRNA 29.8 Down 1.41 NM_0019 24/05/06,15735 speci gp.340 341 Homo sapiens purinergic receptor P2X, ligand- NM_0025 gated ion channel, 3 (P2RX3), mRNA 59 Homo sapiens crystallin, alpha B (CRYAB), NM_0018 mRNA Homo sapiens claudin 11 (oligodendrocyte NM_0056 transmembrane protein) (CLDN1 mRNA 02 Homo sapiens ATP-binding cassette, sub-family NM_0009 B (MDRITAP), member 1 (ABCB1), mRNA 27 Homo sapiens visinin-like 1 (VSNLI), mRNA NM_0033 Homo sapiens ankyrin repeat domain 2 (stretch NM_0203 responsive muscle) (ANKRD2), mRNA 49 Homo sapiens hypothetical protein FLJ31 842 NM_1524 (FLJ31842), mRNA 87 Homo sapiens RNA (guanine-9-) NM_0178 methyltransferase domain containing 1 19 (RG9MTD1), mRNA 28.92 Down 28.49 Down 28.14 Down 27.84 Down 27.75 Down 1 .84E-05 6.27E-06 5.78E-07 8.93E-06 9.37E-06 27.68 Down 2.1 9E-06 27.59 Down 26.6 Down 26.24 Down 3.71 1 .99E-05 1 .67E-05 AA4491 3 7 zxO3dl2.rl Soares-total-fetusNb2HF8_9w Homo sapiens cDNA clone IMAGE:785399 mRNA sequence hd44dll.xl SoaresNFLTGBCSi Homo sapiens cDNA clone IMAGE:2912373 3 similar to contains Alu repetitive element;, mRNA 26.15 Down 9.71 E-06 AW5112 22 sequence ti7OaOl .xl NCICGAPKidi 1 Homo sapiens 25.39 Down 3.10E-06 24/05/06,15735 speci gjs.341 INO -342- A1469032 cDNA clone IMAGE:2137320 3, mRNA sequence Homo sapiens zinc finger protein 323 NM_0308 (ZNF323), mRNA 99 602572521F1 NIH_MGC_77 Homo sapiens BG54530 cDNA clone IMAGE:4700644 5, mRNA sequence Homo sapiens tripartite motif-containing 55 NM_1840 (TRIM55), transcript variant 4, mRNA 87 Homo sapiens tripartite motif-containing 22 NM_0060 (TRIM22), mRNA 74 Homo sapiens zinc finger, CCHC domain NM_1526 containing 5 (ZCCHC5), mRNA 94 Homo sapiens hypothetical protein LOC131368 NM_1750 (LOC131368), mRNA 56 Homo sapiens latrophilin 3 (LPHN3), mRNA NM_0152 36 Homo sapiens cDNA FLJ42883 fis, clone AK12487 BRHIP3006683 25.07 Down 24.4 Down 24.35 Down 24.19 Down 1.43E-05 3.68E-06 9.37E-06 1.55E-04 24.15 Down 23.96 Down 23.83 Down 8.30E-05 2.36E-05 9.13E-06 23.58 Down 1.95E-05 Homo sapiens interleukin 18 (interferon- NM_0015 gamma-inducing factor) (IL18), mRNA 62 Homo sapiens TatD DNase domain containing NM_0320 1 (TATDN1), mRNA 26 23.38 Down 23.12 Down 4.81 6.00E-05 24/05/06,15735 spcci gp,342 -343- Homo sapiens chromosome 7 open reading NM_1527 frame 6 (C7orf6), mRNA 03 Homo sapiens lysyl oxidase-like 3 (LOXL3), NM_0326 mRNA 03 BX1 15825 Soares_NhHMPu_Si Homo sapiens BX11582 cDNA clone IMAGp998C1346O3; IMAGE: 1879236, mRNA sequence Homo sapiens glypican 4 (GPC4), mRNA NM_0014 48 Homo sapiens, clone IMAGE:4179986, mRNA, BC00858 partial cds 22.98 Down 1.82E-05 22.16 Down 1. 17E-05 22.02 Down 21.86 Down 3.22E-05 8.50E-06 21.22 Down 3.19E-06 NM_0022 73 NM_0050 69 Homo sapiens keratin 8 (KRT8), mRNA Homo sapiens single-minded homolog 2 (Drosophila) (SIM2), transcript variant SIM2, mRNA 21.19 Down 20.97 Down 1 .29E-05 3.19E-06 Homo sapiens heart alpha-kinase (HAK), NM_0529 mRNA 47 Homo sapiens mRNA for keratin 19, partial cds, ABO41 26 isolate: Ki9-141 9 Homo sapiens p21 (CDKN1A)-activated kinase NM_0025 3 (PAK3), mRNA 78 Homo sapiens IQ motif containing with AAA NM_0247 domain (IQCA), mRNA 20.9 Down 1 .22E-05 20.57 Down 3.49E-05 20.36 Down 3.19E-06 20.18 Down 1 .02E-04 24105/06,15735 speci gp,343 344 Homo sapiens potassium inward ly-rectifying NM_0186 channel, subfamily J, member 16 (KCNJ 16), 58 transcript variant 1, mRNA AGENCOURT_10398872 NIHMGC_82 Homo BU56780 sapiens cDNA clone IMAGE:6614502 5, mRNA 4 sequence Homo sapiens hyaluronan synthase 3 (HAS3), NM_0053 transcript variant 1, mRNA 29 DKFZp686C09280_ri 686 (synonym: hlcc3) BX5091 1 Homo sapiens cDNA clone DKFZp686C09280 7 5, mRNA sequence Homo sapiens wingless-type MMTV integration NM_0033 site family, member 5A (WNT5A), mRNA 92 Homo sapiens family with sequence similarity NM_0248 31, member C (FAM31C), mRNA 98 19.93 Down 19.73 Down 19.66 Down 19.48 Down 19.4 Down 19.07 Down 3.44E-05 6.27E-06 3.19E-06 8.85E-06 3.1 9E-06 6.27E-06 Homo sapiens pp9974 mRNA, complete cds 19 Down 6.27E-06 AF31 838 2 Homo sapiens mRNA; cONA DKFZp434C128 ALl1757 (from clone DKFZp434C128) 8 UI-H-FL1-bgt-n-07-0-Ul.sl NCICGAPELi BU63316 Homo sapiens cDNA clone UI-H-FL1-bgt-n-07- 3 0-UI 3, mRNA sequence Homo sapiens mRNA for MEGF6 protein AB01 153 (KIAAO815), partial cds 9 Homo sapiens aldehyde dehydrogenase 1 18.69 Down 3.1 7E-06 18.57 Down 9.42E-06 18.38 Down 18.37 Down 4.22E-05 4.97E-05 24/05/06,15735 speci gp. 344 -345- INO NM_0006 family, member A3 (ALDH1IA3), mRNA 93 zr34f08.sl SoaresNhHMPuSi Homo sapiens AA19532 cDNA clone IMAGE:665319 3, mRNA 8 sequence Homo sapiens mRNA; cONA DKFZp564N2216 AL08010 (from clone DKFZp564N2216) 3 Homo sapiens chromosome 8 open reading NM_0201 frame 4 (CUorf4), mRNA Homo sapiens a disintegrin-like and NM_1 829 metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9 (ADAMTS9), transcript variant 1, mRNA Homo sapiens cDNA FLJ14199 fis, clone AK02426 NT2RP300271 3 18.33 Down 18.18 Down 3.85E-05 9.56E-06 17.97 Down 17.95 Down 1. 19E-04 5.64E-05 17.68 Down 17.55 Down 2.24E-05 Homo sapiens fibroblast growth factor binding protein 1 (FGFBP1), mRNA 5.73E-06 NM_0051 nab3l g02.xl BF43104 SoaresNSFF8_9WOTPAPSI Homo 1 sapiens cDNA clone IMAGE:3267627 3, mRNA sequence UI-H-DF1-auf-e-22-0-UI.sl NCICGAPDFl BM99204 Homo sapiens cDNA clone IMAGE:5868669 3, 9 mRNA sequence Homo sapiens cysteine-rich, angiogenic NM_0015 inducer, 61 (CYR61), mRNA 17.25 Down 16.81 Down 16.43 Down 1 .56E-05 8.93E-06 6.87E-04 Homo sapiens cDNA FLJ36210 fis, clone 16.29 Down 1. 16E-05 AK09352 24105/06,15735 speci gp,345 346 THYMU20001 Homo sapiens lung type-I cell membrane- NM_1983 associated glycoprotein (TIA-2), transcript 89 variant 2, mRNA Homo sapiens growth factor receptor-bound NM_0044 protein 14 (GRB14), mRNA Homo sapiens fibrillin 2 (congenital contractural NM_0019 arachnodactyly) (FBN2), mRNA 99 Homo sapiens glutaminyl-peptide NM_0124 cyclotransferase (glutaminyl cyclase) (QPCT), 13 mRNA Homo sapiens WD repeat domain 40B NM_1784 (WDR4OB), mRNA UI-E-EJO-ahi-c-1 6-0-UI. ri UI-E-EJO Homo BM7 1294 sapiens cDNA clone UI-E-EJO-ahi-c-16-0-UI mRNA sequence Homo sapiens EGF-containing fibulin-like NM_0188 extracellular matrix protein 1 (EFEMPI), 94 transcript variant 2, mRNA UI-E-DW1-ahc-b-1 1-0-UI.rl UI-E-DW1 Homo BM71207 sapiens cDNA clone UI-E-DW1 -ahc-b-1 1 -0-UI 2 5, mRNA sequence Homo sapiens hemoglobin, delta (HBD), mRNA NM_0005 19 Homo sapiens serum/glucocorticoid regulated NM_0162 kinase 2 (SGK2), transcript variant 2, mRNA 76 16.15 Down 16.02 Down 16 Down 15.51 Down 2.62E-05 1.52E-04 4.45E-05 1 .39E-05 15.46 Down 15.36 Down 15.15 Down 15.1 Down 14.92 Down 2.73E-05 4.73E-06 5.35E-05 1.93E-05 5.14E-06 14.87 Down 3.13E-06 9.84E-05 7147c Oxi 14.78 Down 24/05/06,15735 speci gp,346 347 BF1 1171 0 SoaresNSFF8_9WOTPAPSi Homo sapiens cDNA clone IMAGE:3524371 3, mRNA sequence Homo sapiens c2lorf 7 form B mRNA, complete AF26916 cds 14.77 Down 5.11 Homo sapiens Down syndrome critical region NM_2034 gene 1 (DSCR1), transcript variant 3, mRNA 18 Homo sapiens ankyrin repeat domain 29 NM_1735 (ANKRD29), mRNA Homo sapiens chromosome 6 open reading NM_0325 frame 168 (C6orfl68), mRNA 11 Homo sapiens hypothetical protein FLJ25378 NM_1527 (FLJ25378), mRNA 68 Homo sapiens protein tyrosine phosphatase, NM_0028 receptor type, B (PTPRB), mRNA 37 14.75 Down 9.03E-04 14.71 Down 14.65 Down 8.60E-05 1.60E-05 14.59 Down 3.47E-05 Homo sapiens adrenergic, alpha-2B-, receptor (ADRA2B3), mRNA NM_0006 82 14.53 Down 14.52 Down 14.35 Down 14.33 Down 8.08E-06 5.46E-05 3.75E-05 Homo sapiens olfactomedin-like 2B NM_0154 (OLFML2B), mRNA Homo sapiens periostin, osteoblast specific factor (POSTN), mRNA 4.23E-05 NM_0064 60250866SF 1 NIHMGC_79 Homo sapiens BG43624 cDNA clone IMAGE:4605617 5, mRNA 14.19 Down 3.75E-05 24/05/06,15735 speci gp, 347 -348sequence Homo sapiens pre-B-cell leukemia transcription NM_0252 factor 4 (PBX4), mRNA Homo sapiens growth differentiation factor 5 NM_0005 (cartilage-derived morphogenetic protein-1) 57 (GDF5), mRNA Homo sapiens myosin, light polypeptide 6, NM_0794 alkali, smooth muscle and non-muscle (MYL6), 23 transcript variant 2, mRNA Homo sapiens ADAMTS-like 3 (ADAMTSL3), NM_2075 mRNA 17 Homo sapiens RAS and EF hand domain NM_1525 containing (RASEF), mRNA 73 Homo sapiens family with sequence similarity NM_0176 46, member A (FAM46A), mRNA 33 Homo sapiens neuritin 1 (NRN1), mRNA NM_0165 88 Homo sapiens likely ortholog of mouse NM_0209 neighbor of Punc E11 (NOPE), mRNA 62 Homo sapiens SPANX family, member B1 NM_0324 (SPANXB1), mRNA 61 601475864F1 NIH_MGC_68 Homo sapiens BE78876 cDNA clone IMAGE:3879014 5, mRNA 3 sequence Homo sapiens cDNA FLJ43501 fis, clone 14.1 Down 1.41E-05 14.06 Down 14.03 Down 13.93 Down 13.93 Down 13.92 Down 13.79 Down 7.14E-05 2.37E-05 1.39E-05 1.72E-04 3.30E-06 1.39E-05 13.78 Down 2.37E-05 13.57 Down 1.09E-05 13.56 Down 13.39 Down 1.39E-05 3.11E-04 24/05/06,15735 spcci gp.348 349 AK12549 PEBLM2004497 0 Homo sapiens interleukin 8 mRNA NM_0005 84 Homo sapiens septin 6 (SEPT6), transcript NM_1458 variant V, mRNA 02 R99527 yq79bl i.si Soares fetal liver spleen 1 NFLS Homo sapiens cDNA clone IMAGE:201981 3, mRNA sequence Homo sapiens par-6 partitioning defective 6 NM_0325 homolog gamma elegans) (PARD6G), mRNA Homo sapiens insulin-like growth factor binding NM_0005 protein 5 (IGFBP5), mRNA 99 Homo sapiens insulin-like growth factor 2 NM_0008 receptor (IGF2R), mRNA 76 Homo sapiens mRNA full length insert cDNA AL38994 clone EUROIMAGE 2005635 13.37 Down 1 .66E-05 13.04 Down 13.01 Down 12.84 Down 12.83 Down 12.74 Down 12.52 Down 9.89E-06 3.09E-05 3.42E-05 1.87E-05 3.58E-04 1.20E-04 Homo sapiens chromosome 3 cDNA 12.43 Down 1. 17E-04 AJ69797 2 H23441 ym52fll1.sl Soares infant brain 1iNIB Homo sapiens cDNA clone IMAGE:51 888 3, mRNA sequence Homo sapiens angiomnotin like 2 (AMOTL-2), NM_0162 mRNA 01 12.39 Down 2.04 12.38 Down 1.31 E-03 24/05/06, 15735 speci gp,349 -350- Homo sapiens annexin A3 (ANXA3), mRNA NM_0051 39 W85910 zh52blO.sl Soares-fetal-liver-spleen 1 NFLSSi Homo sapiens cONA clone IMAGE41 5675 3, mRNA 12.27 Down 12.27 Down 3.1 OE-06 4.22E-05 sequence Homo sapiens lipopolysaccharide-induced TNF NM_0048 factor (LITAF), mRNA 62 Homo sapiens cytochrome P450, family 4, NM_1780 subfamily X, polypeptide 1 (CYP4X1), mRNA 33 Homo sapiens chromosome 21 open reading NM_0201 frame 7 (C2lorf7), mRNA 52 Homo sapiens Ras-related associated with NM_0041 diabetes (RRAD), mRNA Homo sapiens noggin (NOG), mRNA NM_0054 Homo sapiens integrin, beta 3 (platelet NM_0002 glycoprotein Ilila, antigen CD61) (ITGB33), 12 mRNA Homo sapiens mRNA; cDNA DKFZp686JO156 BX64896 (from clone DKFZp686JO1 56) 4 Homo sapiens hypothetical protein NM_0314 DKFZp434BO44 (DKFZP434BO44), mRNA 76 Homo sapiens similar to CG3714 gene product 12.27 Down 12.13 Down 12.12 Down 11.95 Down 11.93 Down 1 .03E-04 3.22E-05 4.27E-06 1.10 E-04 7.24E-06 11.9 Down 8.68E-05 11.85 Down 1 .22E-05 11.84 Down 1.04E-05 11.57 Down 1 .39E-05 24/05/06,15735 speci -351 NM_1452 (PP3856), mRNA 01 Homo sapiens transient receptor potential NM_0161 cation channel, subfamily C, member 4 79 (TRPC4), mRNA Homo sapiens collagen, type VIII, alpha 2 NM_0052 (COL8A2), mRNA 02 df26h11.yl Morton Fetal Cochlea Homo AW0216 sapiens cDNA clone IMAGE:2484717 5, mRNA 86 sequence Homo sapiens heat shock 70kDa protein 12A, BC04141 mRNA (cDNA clone IMAGE:5285193), partial 2 cds Homo sapiens E74-like factor 3 (ets domain NM_0044 transcription factor, epithelial-specific (ELF3), 33 mRNA Homo sapiens autocrine motility factor receptor NM_0011 (AMFR), transcript variant 1, mRNA 44 Homo sapiens leukocyte immunoglobulin-like NM_0068 receptor, subfamily A (with TM domain), 63 member 1 (LILRA1), mRNA BX113319 NCI_CGAP_Gas4 Homo sapiens BX11331 cDNA clone IMAGp998G205398 9 IMAGE:2184619, mRNA sequence Homo sapiens myxovirus (influenza virus) NM_0024 resistance 1, interferon-inducible protein p78 62 (mouse) (MX1), mRNA Homo sapiens mRNA for KIAA0523 protein, AB01109 partial cds 11.56 Down 11.39 Down 11.2 Down 11.17 Down 2.61E-04 2.61E-04 2.21E-05 2.88E-04 11.14 Down 11.14 Down 2.80E-05 5.52E-05 11.04 Down 2.72E-05 10.97 Down 10.93 Down 10.88 Down 2.51E-05 1.17E-04 8.65E-06 24/05/06.15735 speci gp,351 352 Homo sapiens collagen, type XI, alpha 1 NM_001 8 (COLil1Al), transcript variant A, mRNA 54 Homo sapiens layilin (L0C143903), mRNA NM_1788 34 Homo sapiens grancalcin, EF-hand calcium NM_0121 binding protein (GCA), mRNA 98 Homo sapiens FLJ44048 protein (FLJ44048), NM_2074 mRNA 82 Homo sapiens glutamate decarboxylase, 1 NM_0008 (brain, 67kDa) (GADI), transcript variant 17 GAD67, mRNA Homo sapiens nuclear factor (erythroid-derived NM_0042 2)-like 3 (NFE2L-3), mRNA 89 Homo sapiens HERV-H LIR-associating 2 NM_0070 (HHLA2), mRNA 72 qt94all1.xl NCICGAPCol4 Homo sapiens A1355761 cDNA clone IMAGE:1962908 3 similar to gb:X74929 KERATIN, TYPE 11 CYTOSKELETAL 8 (HUMAN);, mRNA sequence 10.81 Down 10.8 Down 9.37E-06 5.28E-06 10.71 Down 1 .57E-05 10.69 Down 10.65 Down 10.42 Down 10.41 Down 10.38 Down 10.3 Down 10.26 Down 3.75E-05 1 .35E-05 4.53E-05 7.19E-06 2.80E-05 1.20E-04 1 .30E-04 NM_0219 77 Homo sapiens solute carrier family 22 (extraneuronal monoamine transporter), member 3 (SLC22A3), mRNA Homo sapiens mRNA; cDNA DKFZp434C19l5 AL1 3769 (from clone DKFZp434C1 915); partial cds 8 24/05/06,15735 speci gp. 35 2 353 UI-CF-EN1-acz-f-03-0-UI.sl UI-CF-EN1 Homo 10.2 Down 1.22E-05 BM97638 sapiens cDNA clone UI-CF-EN1-acz-f-03-0-UI1 3, mRNA sequence Homo sapiens cDNA FLJ41 325 fis, clone 10.05 Down 1.84E-05 AK12331 BRAMY2046871 c-i 9 BX459043 Homo sapiens PLACENTA Homo 9.97 Down 3.27E-04 BX45904 sapiens cDNA clone CSODE01 1YNl10 3- 3 PRIME, mRNA sequence Homo sapiens laminin, alpha 3 (LAMA3), 9.83 Down 5.83 E-06 NM_0002 transcript variant 2, mRNA c-i 27 tb29h06.xl NCI_CGAP_Kid 12 Homo sapiens 9.8 Down 7.24E-06 A1335277 cDNA clone IMAGE:2055803 3, mRNA sequence Homo sapiens FLJ43339 protein (FLJ43339), 9.73 Down 4.97E-05 NM_2073 mRNA Homo sapiens TXK tyrosine kinase (TXK), 9.7 Down 1 .64E-05 NM_0033 mRNA 28 Homo sapiens insulin-like growth factor 2 9.68 Down 2.36E-05 NM_0006 (somatomedin A) (IGF2), mRNA 12 Homo sapiens G protein-coupled receptor 37 9.63 Down 5.63E-06 NM_-0053 (endothelin receptor type B-like) (GPR37), 02 mRNA Homo sapiens limbic system-associated 9.62 Down 4.14E-05 NM_0023 membrane protein (LSAMP), mRNA 38 Homo sapiens programmed cell death 1 ligand 9.57 Down 7.52E-05 NM_0252 2 (PDCD1LG2), mRNA 24/05/06,15735 speci gp, 353 354 39 Homo sapiens alkaline phosphatase, 9.56 Down 1.39E-05 NM_0004 liver/bone/kidney (ALPL), mRNA 78 AJ318805 Homo sapiens adipose tissue Homo 9.55 Down 5.32E-05 AJ31880 sapiens cDNA clone 2040, mRNA sequence 602647476F1I NIHMGC_79 Homo sapiens 9.54 Down 2.76E-05 BG62270 cDNA clone IMAGE:4768963 5, mRNA 7 sequence UI-CF-FNO-aeo-g-21-0-UI.sl UI-CF-FNO Homo 9.49 Down 1.39E-05 CN47859 sapiens cDNA clone UI-CF-FNO-aeo-g-2 7 3, mRNA sequence RC1-CI0045-021000-021-f02 C10045 Homo 9.46 Down 2.31 BF79809 sapiens cDNA, mRNA sequence 8 Homo sapiens guanylate cyclase 1, soluble, 9.42 Down 7.20E-05 NM_0008 alpha 3 (GUCY1A3), mRNA 56 DKFZp761E1224_ri 761 (synonym: hamy2) 9.33 Down 5.73E-06 ALl1976 Homo sapiens cDNA clone DKFZp761 E1224 9 mRNA sequence Homo sapiens nuclear factor I/B (NEIB), mRNA 9.32 Down 2.30E-05 NM_0055 96 UI-H-BI1-abv-a-11-0-UI.sl NCICGAPSub3 9.29 Down 1. 31 E-04 AW1344 Homo sapiens cDNA clone IMAGE:2712885 3, 73 mRNA sequence Homo sapiens mRNA; cDNA DKFZp686F09166 9.28 Down 4.13E-06 BX53769 (from clone DKFZp686FO9 166) 8 Homo sapiens desmocollin 3 (DSC3), transcript 9.27 Down 2.36E-05 24/05/06.15735 speci gp.354 355 NM_0244 variant Dsc3b, mRNA 23 Homo sapiens chemokine (C-C motif) ligand 26 9.27 Down 9.91 E-06 NM_0060 (CCL26), mRNA 72 Homo sapiens solute carrier family 35, member 9.24 Down 5.64E-05 NM_1735 F3 (SLC35F3), mRNA 08 Homo sapiens tubulin, beta polypeptide paralog 9.24 Down 2.21 E-04 NM_1780 (MGC8685), mRNA 12 Homo sapiens midline 1 (Opitz/BBB syndrome) 9.18 Down 8.22E-04 NM_0332 (MIDi), transcript variant 3, mRNA Homo sapiens hypothetical protein FLJ10901 8.95 Down 1.17E-04 NM_0182 (FLJ1O9O1), mRNA H89526 yw28b04.rl Morton Fetal Cochlea Homo 8.91 Down 1 .74E-05 sapiens cDNA clone IMAGE:253519 5, mRNA sequence Homo sapiens prostaglandin 12 (prostacyclin) 8.89 Down 2.82E-04 NM_0009 synthase (PTGIS), mRNA 61 wo8OcO6.xl NCICGAPKidl11 Homo sapiens 8.88 Down 2.07E-05 A1942360 cDNA clone IMAGE:2461642 3, mRNA sequence Homo sapiens mRNA; cDNA 8.86 Down 1.59E-05 BX53761 DKFZp686E1 1117 (from clone 3 DKFZp686E1 1117) Homo sapiens C-type (calcium dependent, 8.84 Down 2.21 NM_0143 carbohydrate-recognition domain) lectin, 58 superfamily member 9 (CLECSF9), mRNA 24/05/06,15735 speci gp. 35 -356- Homo sapiens cDNA FLJ 13937 fis, cione 8.83 Down 1.32E-04 AK02399 Y79AA1000805 C-9 Homo sapiens aldehyde dehydrogenase 1 8.8 Down 4.89E-05 NM_0006 family, member B1 (ALOHi Bi), nuclear gene c-I92 encoding mitochondrial protein, mRNA Homo sapiens fibroblast growth factor 1 (acidic) 8.8 Down 6.22E-05 NM_0331 (FGF1), transcript variant 2, mRNA 36 NOHomo sapiens cDNA FLJ20068 fis, clone 8.8 Down 1.85E-05 AK00007 C0L01755 (NI Homo sapiens cytokine-like protein C17 (C17), 8.77 Down 7.06E-05 NM_0186 mRNA 59 Homo sapiens cDNA FLJ30772 fis, clone 8.59 Down 5.63E-06 AK05533 FEBRA2000757, moderately similar to Homo 4 sapiens BM-009 mRNA Homo sapiens G protein-coupled receptor, 8.53 Down 4.21 E-06 NM_0039 family C, group 5, member A (GPCR5A), mRNA 79 Homo sapiens a disintegrin-like and 8.5 Down 5.37E-05 NM_0142 metalloprotease (reprolysin type) with 43 thrombospondin type 1 motif, 3 (ADAMTS3), mRNA UI-H-DHO-aur-k-12-0-UI.sl NOI CGAP DHO 8.44 Down 7.74E-05 CA43786 Homo sapiens cDNA clone Ul-H-DHO-aur-k-12- 1 0-UI 3, mRNA sequence Homo sapiens peroxisomal membrane protein 8.43 Down 5.70E-04 NM_0186 2, 22kDa (PXMP2), mRNA 63 wq47d09.xl NCIOGAPGC6 Homo sapiens 8.39 Down 4.14E-05 24/05/06,15735 speci gp.356 357 A1953708 cDNA clone IMAGE:2474417 3, mRNA sequence Homo sapiens hypothetical protein L0C90529, 8.37 Down 1.84E-04 BC03431 mRNA (cDNA clone IMAGE:4827425), containing frame-shift errors K-EST0159876 L8SCKO Homo sapiens cONA 8.36 Down 7.40E-06 CB1 1575 clone L8SCKO-8-H08 5, mRNA sequence 4 Homo sapiens phosphoinositide-3-kinase, 8.3 Down 1.40E-04 NM_0050 catalytic, delta polypeptide (PIK3CD), mRNA 26 DKFZp686E1543_ri 686 (synonym: hlcc3) 8.28 Down 2.59E-05 AL70665 Homo sapiens cDNA clone DKFZp686E1543 3 mRNA sequence M60502 Human profilaggrin mRNA, 3 end 8.28 Down 2.62E-05 Homo sapiens ankyrin repeat domain 30A 8.28 Down 4.24E-06 NM_0529 (ANKRD3OA), mRNA 97 Homo sapiens chaperone, ABC1 activity of bcl 8.26 Down 9.37E-06 NM_0202 complex like pombe) (CABC1), mRNA 47 Homo sapiens armadillo repeat containing 4 8.22 Down 4.95E-05 NM_0180 (ARMC4), mRNA 76 Homo sapiens zinc finger protein 258 8.22 Down 6.47E-04 NM_0071 (ZNF258), mRNA 67 Homo sapiens hypothetical protein 8.21 Down 1.46E-05 NM_0166 DKFZp434L142 (DKFZp434L142), mRNA 13 Homo sapiens Mst3 and SOKII-related kinase 8.19 Down 1.06E-04 NM_0165 (MST4), mRNA 24/05/06,15735 speci gp.357 358 42 Homo sapiens glutathione peroxidase 1 NM_0005 (GPX1), transcript variant 1, mRNA 81 Homo sapiens cDNA FLJ34795 fis, clone AK0921 1 NT2NE2005921 4 Homo sapiens cDNA FLJ42786 fis, clone AK1 2477 BRAWH300676 1 6 Homo sapiens cDNA FLJ42712 fis, clone AK1 2470 BRAMY3008044 2 Homo sapiens visinin-like 1 (VSNL1), mRNA NM_0033 Homo sapiens likely ortholog of mouse limb-bud NM_0309 and heart gene (LBH), mRNA 8.18 Down 3.53E-04 8.11 Down 3.10E-06 8.11 Down 2.02E-05 8.1 Down 6.75E-06 8.1 Down 3.19E-06 8.09 Down 3.86E-05 CD72379 8 oj26f04.yl Human lacrimal gland, unamplified: oj Homo sapiens cDNA clone oj26f04 5, mRNA sequence 8.08 Down 8.05 Down 2.04 E-04 2.29E-05 601649770F1 NIHMGC_74 Homo sapiens BE96859 cDNA clone IMAGE:3933472 5, mRNA 6 sequence Homo sapiens mRNA for KIAA0994 protein, AB02321 partial cds 1 Homo sapiens ATX1 antioxidant protein 1 NM_0040 homolog (yeast) (ATOXi), mRNA 8.05 Down 1 .74E-04 8.02 Down 1 .42E-04 Homo sapiens mRNA for FLJO0 168 protein 7.99 Down 2.58E-04 24/05/06,15735 speci gp,358 -359- AK07409 7 Homo sapiens hypothetical protein L0C253982 7.98 Down 2.03E-04 NM_1817 (L0C253982), mRNA 18 Homo sapiens pyrimidinergic receptor P2Y, G- 7.94 Down 9.37E-06 NM_0041 protein coupled, 6 (P2RY6), transcript variant 4, 54 mRNA Homo sapiens ankyrin repeat domain 1 (cardiac 7.92 Down 1 .03E-04 NM_0143 muscle) (ANKRD1), mRNA 91 Homo sapiens similar to RIKEN cDNA 7.89 Down 2.67E-05 NM_0806 2310030G06 gene (MGC14839), mRNA 59 Homo sapiens solute carrier family 39 (zinc 7.87 Down 4.83E-04 NM_01 23 transporter), member 6 (SLC39A6), mRNA 19 Homo sapiens crumbs homolog 3 (Drosophila) 7.86 Down 2.20E-03 NM_1 391 (CRB3), transcript variant 2, mRNA 61 Homo sapiens mRNA; cDNA DKFZp686J04125 7.85 Down 1.74E-05 BX64829 (from clone DKFZp686J04125) 9 H94320 yvl 8bl 0.sl Soares fetal liver spleen 1 NFLS 7.84 Down 8.68E-05 Homo sapiens cDNA clone IMAGE:-243067 3, mRNA sequence Homo sapiens matrix metalloproteinase 7 7.83 Down 4.28E-04 NM_0024 (matrilysin, uterine) (MMP7), mRNA 23 Homo sapiens cDNA FLJ25283 fis, clone 7.7 Down 5.51 AK05801 STM06716 2 24/05/06,15735 speci gp,35 9 -360- T56535 yb33g07.rl Stratagene fetal spleen (#937205) 7.69 Down 2.72E-05 Homo sapiens cDNA clone IMAGE:73020 mRNA sequence Homo sapiens guanylate binding protein 1, 7.68 Down 9.91 E-06 NM_0020 interferon-inducible, 67kDa (GBP1), mRNA 53 Homo sapiens B-factor, properdin mRNA 7.64 Down 4.89E-05 NM_0017 Homo sapiens cDNA FLJ45513 fis, clone 7.63 Down 8.90E-05 AK12742 BRTHA2021450 1 Homo sapiens yippee-like 5 (Drosophila) 7.58 Down 5.26E-04 NM_0160 (YPEL5), mRNA 61 Homo sapiens KDEL (Lys-Asp-Glu-Leu) 7.57 Down 4.41 E-04 NM_0068 endoplasmic reticulum protein retention receptor 3 (KDELR3), transcript variant 1, mRNA ta48dlO.x2 NCICGAPLu25 Homo sapiens 7.55 Down 1.93E-04 A1311296 cDNA clone IMAGE:2047315 3, mRNA sequence Homo sapiens tumor necrosis factor (ligand) 7.55 Down 4.68E-04 NM_0038 superfamily, member 10 (TNFSF1O), mRNA wj45h05.xl NCICGAPLul 9 Homo sapiens 7.54 Down 2.62E-05 A1819863 cDNA clone IMAGE:2405817 3, mRNA sequence Homo sapiens cyclin-dependent kinase inhibitor 7.53 Down 2.31 NM_0000 10 (p57, Kip2) (CDKN 10), mRNA 76 Homo sapiens vesicle-associated membrane 7.53 Down 6.69E-05 24/05/06,15735 speci gp,360 -361 NM_0037 protein 8 (endobrevin) (VAMP8), mRNA 61 Homo sapiens chromosome 11 open reading 7.5 Down 1 .89E-04 NM_0034 frame 13 (Cllorfl3), mRNA Homo sapiens CTAGE family, member 4 7.47 Down 2.61 NM_1984 (CTAGE4), mRNA Homo sapiens mRNA; cDNA DKFZp586J1717 7.4 Down 2.32E-04 ALl1745 (from clone DKFZp586J1717) 4 Homo sapiens hypothetical protein FLJ20920 7.4 Down 1.67E-05 NM_0251 (FLJ20920), mRNA 49 Homo sapiens neuronal pentraxin I (NPTXI), 7.37 Down 2.29E-05 NM_0025 mRNA 22 Homo sapiens RAB3B3, member RAS oncogene 7.37 Down 3.28E-05 NM_0028 family (RAB3B3), mRNA 67 Homo sapiens cDNA FLJ1 1575 fis, clone 7.36 Down 4.12E-05 AK02163 HEMBA1003531 7 Homo sapiens mRNA full length insert cDNA 7.35 Down 1 .12E-05 AL35905 clone EUROIMAGE 592473 8 Homo sapiens IA-2 gene, intron 18 7.33 Down 5.57E-05 AF1 0809 3 Homo sapiens cDNA: FLJ22582 fis, clone 7.32 Down 1.55E-04 AK02623 HS102576 24/05/06,15735 speci gp.361 -362- O Homo sapiens hypothetical zinc finger protein 7.31 Down 6.09E-05 SNM_0221 FLJ14011 (FLJ14011), mRNA 03 Homo sapiens glutamyl aminopeptidase 7.22 Down 9.96E-05 in NM_0019 (aminopeptidase A) (ENPEP), mRNA 77 BX111520 Soares placenta Nb2HP Homo 7.21 Down 7.14E-06 SBX11152 sapiens cDNA clone IMAGp998L15208; 0 IMAGE:141470, mRNA sequence ,O Homo sapiens pleckstrin homology, Sec7 and 7.2 Down 1.76E-03 NM_0174 coiled-coil domains 1(cytohesin 1) (PSCD1), 56 transcript variant 2, mRNA Homo sapiens neuregulin 1 (NRG1), transcript 7.19 Down 2.88E-04 NM_0139 variant GGF2, mRNA 62 S70348 Homo sapiens integrin beta 3 mRNA, partial 7.18 Down 2.47E-05 cds, alternatively spliced U51694 HSU51694 Human normal gingiva Homo 7.13 Down 6.48E-06 sapiens cDNA, mRNA sequence Homo sapiens calponin 1, basic, smooth 7.07 Down 2.91E-05 NM_0012 muscle (CNN1), mRNA 99 Homo sapiens cytidine deaminase (CDA), 7.02 Down 3.22E-05 NM_0017 mRNA Homo sapiens G protein-coupled receptor 23 6.94 Down 1.65E-04 NM_0052 (GPR23), mRNA 96 Homo sapiens cytoplasmic polyadenylation 6.94 Down 5.63E-06 NM_0305 element binding protein 1 (CPEB1), mRNA 94 24/05/06,15735 speci gp.362 -363- BX113144 Soares placenta Nb2HP Homo 6.93 Down 4.14E-05 BX11314 sapiens cDNA clone IMAGp998N07225; 4 IMAGE:148038, mRNA sequence Homo sapiens mRNA for KIAA0833 protein, 6.91 Down 5.63E-06 AB02064 partial cds 0 Homo sapiens clone L49 HERV-K-T47-like long 6.86 Down 1.29E-04 AF24457 terminal repeat sequence 1 Homo sapiens fibrinogen, B beta polypeptide 6.85 Down 2.24E-04 NM_0051 (FGB), mRNA 41 Homo sapiens odd-skipped-related 2A protein 6.84 Down 2.30E-05 NM_0530 (OSR2), mRNA 01 zr33a09.rl Soares_NhHMPu_S1 Homo sapiens 6.82 Down 2.73E-05 AA19572 cDNA clone IMAGE:665176 5, mRNA 7 sequence Homo sapiens baculoviral IAP repeat- 6.81 Down 2.02E-04 NM_0011 containing 3 (BIRC3), transcript variant 1, mRNA Homo sapiens glycoprotein A repetitions 6.81 Down 2.00E-04 NM_0055 predominant (GARP), mRNA 12 Homo sapiens cyclic nucleotide gated channel 6.81 Down 5.65E-05 NM_0000 alpha 1 (CNGA1), mRNA 87 Homo sapiens coagulation factor III 6.74 Down 1.42E-04 NM_0019 (thromboplastin, tissue factor) mRNA 93 Homo sapiens midline 1 fetal kidney isoform 3 6.73 Down 6.70E-05 AF04121 (MID1) mRNA, partial cds 24/05/06.15735 speci gp,363 364 0 Homo sapiens phosphodiesterase 5A, cGMP- 6.73 Down 7.71 E-06 NM_0010 specific (PDE5A), transcript variant 1, mRNA 83 Homo sapiens protein tyrosine phosphatase, 6.72 Down 2.36E-05 NM_0124 non-receptor type 22 (lymphoid) (PTPN22), 11 transcript variant 2, mRNA Homo sapiens sialyltransferase 7 ((alpha-N- 6.71 Down 3.90E-04 NM_0309 acetyl neu ram inyl-2,3-beta-ga lactosyl-1, acetyl galactosaminide alpha-2,6sialyltransferase) E (SIAT7E), mRNA Homo sapiens glutathione S-transferase pi 6.7 Down 6.35E-05 NM_0008 (GSTP1), mRNA 52 Homo sapiens voltage-dependent calcium 6.7 Down 1 .38E-05 BC04636 channel gamma subunit-like protein, mRNA 2 (cDNA clone MGC:50757 IMAGE:5221396), complete cds Homo sapiens SPOC domain containing 1 6.66 Down 5.03E-05 NM_1445 (SPOCD1), mRNA 69 Homo sapiens TNFAIP3 interacting protein 1 6.61 Down 1.01 E-03 NM_0060 (TNIP1I), mRNA 58 S54641 HZF-16=Kruppel-related zinc finger gene 6.59 Down 6.25E-04 homolog {alternatively spliced) [human, hepatoblastoma cell line, HEP-G2, mRNA, 2080 nt] Homo sapiens YEATS domain containing 2 6.58 Down 5.94E-04 NM_0180 (YEATS2), mRNA 23 Homo sapiens inhibin, beta B (activin AB beta 6.56 Down 5.11E-05 NM_0021 24/05/06,15735 speci 6p,364 365 93 polypeptide) (INHBB), mRNA Homo sapiens chromosome 9 open reading 6.55 Down 4.93E-04 NM_0314 frame 58 (C9orf58), transcript variant 1, mRNA 26 aj93h05.xl NCIOGAPKid3 Homo sapiens 6.53 Down 5.14E-06 A1244954 cDNA clone IMAGE:1867065 3, mRNA sequence Homo sapiens mRNA; cDNA DKFZp686N164O 6.51 Down 1.44E-04 BX53754 (from clone DKFZp686N164O) 7 Homo sapiens ribosomal protein L19 (RPL1 6.49 Down 1.39E-04 NM_0009 mRNA 81 Homo sapiens cONA FLJ25283 fis, clone 6.48 Down 1.57E-05 AK05801 STMO671 6 2 Homo sapiens hypothetical protein EUJ14054 6.48 Down 2.40E-04 NM_0245 (FLJ14054), mRNA 63 Homo sapiens contactin 1 (CNTN1), transcript 6.47 Down 1.91 NM_0018 variant 1, mRNA 43 L0761 5 Human neuropeptide Y receptor Y1 (NPYY1) 6.46 Down 2.22E-04 mRNA, exon 2-3 and complete cds Homo sapiens sorting nexin 10 (SNX1O 6.44 Down 7.33E-05 NM_0133 mRNA 22 Homo sapiens immunoglobulin superfamily, 6.41 Down 2.37E-05 NM_0143 member 4 (IGSF4), mRNA 33 Homo sapiens hypothetical protein FLJ39553 6.41 Down 1.42E-05 NM_1735 (FLJ39553), mRNA 24/05/06,15735 speci gp,365 -366- BF50992 NM_0035 97 NM_1523 69 UI-H-B314-aph-c-10-0-UI.sl NOICGAPSub8 Homo sapiens cDNA cione IMAGE:3087355 3, mRNA sequence Homo sapiens TGFB inducible early growth response 2 (TIEG2), mRNA Homo sapiens hypothetical protein MGC45474 (MGC45474), mRNA Homo sapiens prominin 2 (PROM2), mRNA 6.39 Down 6.39 Down 6.39 Down 6.38 Down 4.05E-05 1 .22E-05 3.75E-05 1.04E-04 NM_1447 07 Homo sapiens coagulation factor C homolog, NM_0040 cochlin (Limulus polyphemus) (GOGH), mRNA 86 Homo sapiens tuftelin 1 (TUFTi), mRNA NM_0201 27 Homo sapiens cytochrome P450, family 1, NM_0001 subfamily B, polypeptide 1 (CYPi13i), mRNA 04 Homo sapiens citrate lyase beta like (CLYBL), NM_2068 transcript variant 2, mRNA 08 Homo sapiens breast cancer anti-estrogen NM_0035 resistance 3 (BCAR3), mRNA 67 Homo sapiens regulator of G-protein signalling NM_0036 5 (RGS5), mRNA 17 Homo sapiens cDNA FLJ26671 fis, clone 6.37 Down 6.37 Down 1.91 2.93E-03 6.35 Down 1 .46E-05 6.32 Down 5.22E-05 6.31 Down 6.29 Down 1 .39E-05 2.36E-04 6.28 Down 6.69E-05 24/05/06,15735 speci gp.366 -367- AK13018 MPG03325 1 Homo sapiens CGI-26 protein (CGI-26), mRNA NM_0159 54 Homo sapiens diphtheria toxin receptor NM_0019 (heparin-binding epidermal growth factor-like growth factor) (DTR), mRNA 6.27 Down 2.50 E-04 6.27 Down 2.56E-03 NM_0005 97 NM_0209 92 Homo sapiens insulin-like growth factor binding protein 2, 36kDa (IGFBP2), mRNA Homo sapiens PDZ and LIM domain 1 (elfin) (PDLIM1), mRNA Homo sapiens interleukin 1, beta (ILl mRNA 6.26 Down 6.25 Down 6.22 Down 2.29E-04 8.97E-05 2.34E-05 NM_0005 76 NM_0228 18 NM_0012 57 Homo sapiens microtubule-associated protein 1 light chain 3 beta (MAPi LC3B3), mRNA Homo sapiens cadherin 13, H-cadherin (heart) (CDH13), mRNA 6.22 Down 6.21 Down 6.21 Down 6.21 Down 1.18 E-03 4.57E-04 2.37E-05 1.16 wel 8fO6.xl NCI_CGAP_Lu24 Homo sapiens A1697906 cDNA clone IMAGE:2341475 3, MRNA sequence Homo sapiens cDNA FLJ43707 fis, clone AK1 2569 TESOP2001 865 Homo sapiens tetraspan 2 (TSPAN-2), mRNA 6.21 Down 7. 32E-05 NM_0057 24/05/06,15735 speci gp, 36 7 368 SoaresNFLTGBCSi Homo 6.2 Down 1.44E-04 Ai694344 sapiens cDNA clone IMAGE:2331 117 3 similar to contains MER1 3.bl MER1 3 repetitive element;, mRNA sequence Homo sapiens cathepsin L2 (CTSL2), mRNA 6.19 Down 3.43E-04 NM_0013 33 tu89b07.xl NCICGAPGas4 Homo sapiens 6.18 Down 1.38E-04 A1623139 cDNA clone IMAGE:2258197 3, mRNA sequence Homo sapiens cadherin 10, type 2 (T2- 6.17 Down 6.43E-05 NM_0067 cadherin) (CDH1O), mRNA 27 M80899 Human novel protein AHNAK mRNA, partial 6.16 Down 6.38E-04 sequence Homo sapiens malonyl-CoA decarboxylase 6.15 Down 3.70E-05 NM_0122 (MLYCD), mRNA 13 Homo sapiens dapper homolog 1, antagonist of 6.14 Down 6.41 NM_0166 beta-catenin (xenopus) (DACTi), mRNA 51 Homo sapiens coagulation factor XIII, All 6.14 Down 9.71 E-06 NM_0001 polypeptide (F13A1), mRNA 29 Homo sapiens thioredoxin interacting protein 6.11 Down 1.43E-03 NM_0064 (TXNIP), mRNA 72 UI-E-CRO-ach-e-1 2-0-UI.sl UI-E-CRO Homo 6.09 Down 7.54E-05 BU72709 sapiens cDNA clone UI-E-CR0-ach-e-1 2-0-Ul 3, 6 mRNA sequence Homo sapiens clone 24739 mRNA sequence 6.04 Down 8.86E-05 AF07057 24/05/06.15735 speci gp,368 369 1 Homo sapiens armadillo repeat containing 1 6.02 Down 2.51 E-03 NM_0181 (ARMC1), mRNA UI-H-EZO-bar-b-22-0-UI.sl NCi CGAP Chi 6.02 Down 4.69E-05 CA41484 Homo sapiens cDNA clone Ul-H-EZO-bar-b-22- 7 0-UI 3, mRNA sequence xyO6flO.xl NCICGAPLyml2 Homo sapiens 6.01 Down 8.88E-05 AW4747 cDNA clone IMAGE:2852395 3, mRNA 73 sequence Homo sapiens GLI pathogenesis-related 1 6.01 Down 2.98E-05 NM_0068 (glioma) (GLIPRi), mRNA 51 Homo sapiens activating transcription factor 7 6 Down 1 .65E-04 NM_0249 interacting protein 2 (ATF7IP2), mRNA 97 Homo sapiens suppression of tumnorigenicity 13 6 Down 4.81 E-04 NM_0039 (colon carcinoma) (Hsp7O interacting protein) 32 (ST13), mRNA T53523 ya89h12.rl Stratagene placenta (#937225) 5.99 Down 1.60E-04 Homo sapiens cDNA clone IMAGE:68903 mRNA sequence Homo sapiens Fl 1 receptor (Fl 1 transcript 5.99 Down 7.76E-04 NM_0169 variant 1, mRNA 46 Homo sapiens partial mRNA for keratin 5.99 Down 1 .74E-05 AJ40694 associated protein 4.9 (KRTAP4.9 gene) 1 UI-H-B314-apa-b-08-0-UI.sl NCICGAPSub8 5.93 Down 3.17E-05 BF51049 Homo sapiens cDNA clone IMAGE:.3086558 3, 3 mRNA sequence Homo sapiens cDNA FLJ37117 fis, clone 5.92 Down 1.58E-04 24/05/06,1 5735 speci gp.369 370 AK09443 BRACE2022270 6 Homo sapiens Cbl-interacting protein Sts-1 5.92 Down 1.67E-05 NM_0328 (STS-1), mRNA 73 Homo sapiens retinoic acid induced 14 (RAI14), 5.91 Down 3.19E-03 NM_0155 mRNA 77 Homo sapiens KIAA0408 (K1AA0408), mRNA 5.91 Down 5.11E-05 NM_0147 02 Homo sapiens mRNA for KIAA0471 protein, 5.88 Down 1 .65E-04 AB00794 partial cds 0 Homo sapiens fucosyltransferase 7 (alpha 5.87 Down 3.82E-05 NM_0044 fucosyltransferase) (FUT7), mRNA 79 Homo sapiens, clone IMAGE:3871970, mRNA, 5.86 Down 9.99E-05 BC03559 partial cds 9 Homo sapiens catenin (cadherin-associated 5.84 Down 1.73E-05 NM_0013 protein), delta 2 (neural plakophilin-related arm- 32 repeat protein) (CTNND2), mRNA Homo sapiens acyl-CoA synthetase long-chain 5.83 Down 4.26E-04 NM_0019 family member 1 (ACSL1), mRNA Homo sapiens UDP glycosyltransferase 2 5.82 Down 4.93E-05 NM_0530 family, polypeptide B28 (UGT2B28), mRNA 39 Homo sapiens, Similar to otoconin 90, clone 5.81 Down 5.63E-06 BC01510 IMAGE:4044247, mRNA 8 24/05/06,15735 speci gp, 37 0 -371 Homo sapiens potassium intermediate/small 5.8 Down 1.60E-05 NM_0022 conductance calcium-activated channel, subfamily N, member 4 (KCNN4), mRNA Homo sapiens mRNA; cDNA DKFZp566L2Q3 5.76 Down 6.05E-05 ALl 1742 (from clone DKFZp566L2O3) Homo sapiens KIAA071 1 gene product 5.74 Down 7.24E-06 NM_0148 (KIAAO711), mRNA 67 AGENCOURT-6484255 NIH-MGC-72 Homo 5.73 Down 2.36E-05 BM47382 sapiens cDNA clone IMAGE:5538225 5, mRNA 3 sequence Homo sapiens chromosome 14 open reading 5.73 Down 8.48 E-04 NM_0245 frame 138 (Cl4orfl38), mRNA 58 Homo sapiens LIM domain containing preferred 5.71 Down 7.52E-05 NM_0055 translocation partner in lipoma (LPP), mRNA 78 Homo sapiens cDNA FLJ42181 fis, clone 5.7 Down 2.30E-03 AK12417 THYMU2031368 Homo sapiens fibronectin leucine rich 5.69 Down 1 .38E-05 NM_0132 transmembrane protein 3 (FLRT3), transcript 81 variant 1, mRNA nv66cll1.sl NCI_CGAP_GCB1 Homo sapiens 5.69 Down 1.42E-04 AA68929 cDNA clone IMAGE: 1234772 3, mRNA 2 sequence Homo sapiens prefoldin 1 (PFDN1), mRNA 5.69 Down 1.69E-03 NM_0026 22 UI-E-CL1-aez-k-18-0-UI.rl UI-E-CL1 Homo 5.68 Down 2.37E-03 BM69504 sapiens cDNA clone U l-E-CL1 -aez-k-1 8-0-Ul 24/05/06,15735 spcci gp,3 7 1 372 3 mRNA sequence Homo sapiens zinc finger protein 146 5.67 Down 6.48E-04 NM_0071 (ZNF146), mRNA Homo sapiens cysteine and glycine-rich protein 5.67 Down 2.33E-04 NM_0040 1 (CSRP1), mRNA 78 N75271 yz74h12.rl 5.67 Down 7.47E-05 Soares-multiple sclerosis_2NbHMSP Homo sapiens cDNA clone IMAGE:288839 5, mRNA sequence Homo sapiens mRNA; cDNA DKFZp761 J1112 5.66 Down 3.88E-05 AL35394 (from clone DKFZp761 J1112) 4 DKFZp586B0623_ri 586 (synonym: hutel) 5.63 Down 1.65E-04 AL04796 Homo sapiens cDNA clone DKFZp586B0623, 0 mRNA sequence Homo sapiens mRNA for FLJO0307 protein 5.63 Down 2.25E-04 AK1 31 09 2 Homo sapiens signal-induced proliferation- 5.63 Down 8.36E-04 NM_0208 associated 1 like 2 (SIPA1IL2), mRNA 08 Homo sapiens dysferlin, limb girdle muscular 5.6 Down 5.21 NM_0034 dystrophy 2B (autosomal recessive) (DYSF), 94 mRNA Homo sapiens chromosome 20 open reading 5.58 Down 1.93E-05 NM_0328 frame 100 (C20orflOO), mRNA 83 Homo sapiens microphthalmia-associated 5.57 Down 1.99E-04 NM_0067 transcription factor (MITF), transcript variant 3, 22 mRNA 24/05/06,15735 speci gp,3 7 2 373 Homo sapiens sortilin-related VPS10 domain 5.57 Down 4.68E-05 NM_0149 containing receptor 3 (SORCS3), mRNA 78 BX1 10418 NCICGAPKid3 Homo sapiens 5.56 Down 5.10E-05 BX1 1041 cONA cione IMAGp998C224149; 8 IMAGE: 1635405, mRNA sequence Homo sapiens discs, large homolog 1 5.56 Down 1.21 E-04 NM_0040 (Drosophila) (OLGI), mRNA 87 NOHomo sapiens glutathione S-transferase M1 5.54 Down 5.63E-06 NM_0005 (GSTM1), transcript variant 1, mRNA 61 Homo sapiens mucosa associated lymphoid 5.53 Down 2.39E-04 NM_0067 tissue lymphoma translocation gene 1 (MALTi), transcript variant 1, mRNA Homo sapiens pannexin 2 (PANX2), mRNA 5.52 Down 2.09E-05 NM_0528 39 Homo sapiens transcriptional coactivator 5.51 Down 1.35E-03 NM_0250 tubedown-1 00 (TBDNI100), transcript variant 2, mRNA Homo sapiens desmocollin 2 (DSC2), transcript 5.5 Down 7.12E-05 NM_0244 variant Dsc2a, mRNA 22 Homo sapiens lactate dehydrogenase C 5.5 Down 8.50E-06 NM_01 74 (LDHC), transcript variant 2, mRNA 48 Homo sapiens cDNA FLJ46155 fis, clone 5.5 Down 2.58E-03 AKi 2803 TEST14001 517, moderately similar to Keratin, 6 type I cytoskeletal 18 Homo sapiens ovary-specific acidic protein 5.47 Down 5.65E-04 NM_0326 (OSAP), mRNA 24/05/06,15735 spcci gp. 373 -374- 23 BX1 16347 NCICGAPKidl2 Homo sapiens 5.47 Down 1.65E-04 BX11634 cDNA clone IMAGp998B3215967; 7 IMAGE:2401844, mRNA sequence Homo sapiens fyn-related kinase (ERK), mRNA 5.45 Down 2.62E-05 NM_0020 31 UI-H-EZO-bat-h-1 2-0-UI si NCI CGAP Ch 1 5.45 Down 1.32E-04 CA41374 Homo sapiens cDNA clone UI-H-EZO-bat-h-12- 4 0-UI113, mRNA sequence T78754 ydOlfO8.rl Soares infant brain iNIB Homo 5.45 Down 1.14E-04 sapiens cDNA clone IMAGE:24180 5, mRNA sequence Homo sapiens tripartite motif-containing 25 5.44 Down 4.71 E-04 NM_0050 (TRIM25), mRNA 82 Homo sapiens lactamase, beta (LACTB3), 5.43 Down 6.74E-04 NM_0328 nuclear gene encoding mitochondrial protein, 57 transcript variant 1, mRNA Homo sapiens hypothetical protein L0C285533 5.43 Down 1. 72 E-04 NM_1736 (L0C285533), mRNA 62 Homo sapiens inhibitor of DNA binding 2, 5.43 Down 2.13E-04 NM_0021 dominant negative helix-loop-helix protein (0D2), 66 mRNA Homo sapiens transporter 1, ATP-binding 5.42 Down 5.84E-04 NM_0005 cassette, sub-family B (MDRITAP) (TAPi), 93 mRNA Ul-H-DHO-arx-p-21-0-UI.sl NCICGAPDHO 5.42 Down 2.89E-05 BM98864 Homo sapiens cDNA clone IMAGE:5855492 3, 2 mRNA sequence Homo sapiens hypothetical protein FLJ22457 5.41 Down 4.87E-04 24/05/06,15735 speci gp.374 375 INO NM_0249 (FLJ22457), mRNA 01 Homo sapiens dual specificity phosphatase 23 5.41 Down 5.55E-04 NM_0178 (DUSP23), mRNA 23 BX107838 NCICGAPLu5 Homo sapiens 5.39 Down 2.44E-04 BX10783 cDNA clone IMAGp998A1 53853;- 8 IMAGE: 1521686, mRNA sequence xjO5eO4.xl NCICGAPUt2 Homo sapiens 5.39 Down 1.67E-05 AW1 729 cDNA clone IMAGE:2656350 3, mRNA 03 sequence BX111321 Soares-pregnant uterusNbHPU 5.39 Down 1.46E-03 BX1 1132 Homo sapiens cDNA clone 1MAGp998C221 112 1 IMAGE:469197, mRNA sequence Homo sapiens hypothetical gene supported by 5.38 Down 1.15E-04 NM_0332 AF038182; BC009203 (L0C90355), mRNA 11 D62831 HUM33OB12B Clontech human aorta polyA+ 5.37 Down 5.80E-03 mRNA (#6572) Homo sapiens cDNA clone GEN-330B12 5, mRNA sequence Homo sapiens tubulin, beta polypeptide 5.36 Down 4.71 E-04 NM_0010 (TUBB), mRNA 69 Homo sapiens BCL-2-associated X protein 5.36 Down 8.14E-04 NM_0043 (BAX), transcript variant beta, mRNA 24 AV736303 CB Homo sapiens cDNA clone 5.36 Down 4.51 AV73630 CBCAJD04 5, mRNA sequence 3 Homo sapiens cDNA FLJ 16761 fis, clone 5.34 Down 9.55E-05 AK1 3153 BRAMY3008096 2 24/05/06,1 5735 spei gp,3 7 376 Homo sapiens Shroom-related protein (ShrmL), 5.34 Down 1.21 E-04 NM_0208 mRNA 59 Homo sapiens serine (or cysteine) proteinase 5.34 Down 8.70E-05 NM_0025 inhibitor, clade B (ovalbumin), member 2 (SERPINB2), mRNA Homo sapiens transmembrane protein vezatin 5.33 Down 6.62E-04 INM_0175 (VEZATIN), mRNA 99 NOBX116071 Soares-pregnant uterusNbHPU 5.33 Down 1.39E-04 BX1 1607 Homo sapiens cDNA clone IMAGp998L201 165 1 ;IMAGE:489763, mRNA sequence Homo sapiens hypothetical protein FLJ14001 5.32 Down 5.07E-06 NM_0246 (FLJ14001), mRNA 77 Homo sapiens mRNA; cDNA DKFZp686H157 5.32 Down 4.37E-04 AL83277 (from clone DKFZp686H157) 9 Homo sapiens oligophrenin 1 (OPHN1), mRNA 5.32 Down 5.03E-05 NM_0025 47 Homo sapiens opsin 3 (encephalopsin, 5.3 Down 4.04E-04 NM_0143 panopsin) (OPN3), mRNA 22 Homo sapiens solute carrier family 22 (organic 5.29 Down 1 .92E-04 NM_0030 cation transporter), member 1 (SLC22A1), 57 transcript variant 1, mRNA UI-CF-ENO-acp-e-22-0-UI .sl U I-CF-ENO Homo 5.28 Down 4.06E-04 BM96919 sapiens cDNA clone UI-CF-ENO-acp-e-22-0-UI 1 3, mRNA sequence S69208 troponin T [human, skeletal and cardiac muscle, 5.28 Down 7.73E-04 mRNA, 932 nt] 24/05/06,15735 speci gp.3 7 6 377 NOHomo sapiens SEWi-like cerevisiae) 5.27 Down 1. 17E-03 NM_0312 (SEMIL), mRNA 16 Homo sapiens scaffold attachment factor B 5.27 Down 5.52E-04 V')INM_0029 (SAFB), mRNA 67 Homo sapiens protein tyrosine phosphatase, 5.27 Down 5.63E-06 NM_0028 receptor type, J (PTPRJ), mRNA c-I 43 NOHomo sapiens Jun dimerization protein 5.27 Down 3.06E-05 NM_0186 p21 SINFT (SINFT), mRNA C-I 64 Homo sapiens glucosidase, beta (bile acid) 2 5.25 Down 3.07E-04 NM_0209 (GBA2), mRNA 44 UI-H-COO-aql-b-05-0-UI.sl NClCGAPSub9 5.24 Down 8.03E-05 BM98720 Homo sapiens cDNA clone IMAGE:3104192 3, 0 mRNA sequence Homo sapiens G protein-coupled receptor 87 5.23 Down 2.05E-04 NM_0239 (GPR87), mRNA Homo sapiens neurobeachin (NBEA), mRNA 5.23 Down 2.95E-05 NM_0156 78 Homo sapiens EPH receptor A4 (EPHA4), 5.22 Down 1 .93E-05 NM_0044 mRNA 38 Homo sapiens integrin, alpha 7 (ITGA7), mRNA 5.22 Down 2.36E-05 NM_0022 06 xl92h06.xl NCICGAPUti Homo sapiens 5.22 Down 7.14E-05 AW5914 cDNA clone IMAGE:2682203 3, mRNA 24/05/06,15735 spedi gp,3 77 -378- 61 sequence Homo sapiens cDNA FLJ31471 fis, clone 5.19 Down 3.29E-04 AK05603 NT2NE2001435 3 Homo sapiens CNDP dipeptidase 2 5.19 Down 3.74E-03 NM_0182 (metal lopeptidase M20 family) (CNDP2), mRNA AV728294 HTC Homo sapiens cDNA clone 5.19 Down 3.05E-04 AV72829 HTCBIE09 5, mRNA sequence 4 Homo sapiens hypothetical protein FLJ23518 5.18 Down 2.56E-03 NM_0247 (FLJ2351 mRNA Homo sapiens carboxypeptidase M (CPM), 5.18 Down 4.89E-05 NM_0018 transcript variant 1, mRNA 74 W30761 zb76g12.r1 5.15 Down 1.61 E-04 Soares senescent fibroblasts NbHSF Homo sapiens cDNA clone IMAGE:309574 5, mRNA sequence K-EST0014724 S7SNU719 Homo sapiens 5.14 Down 1.15E-02 BM74199 cDNA clone S7SNU719-7-F05 5, mRNA 7 sequence Homo sapiens DIRAS family, GTP-binding 5.14 Down 1 .38E-03 NM_0175 RAS-like 2 (DIRAS2), mRNA 94 Homo sapiens chromosome 9 open reading 5.13 Down 2.67E-05 NM_0223 frame 19 (C9orf19), mRNA 43 Homo sapiens tumor protein D52-Iike 1 5.13 Down 2.71 NM_0032 (TPD52L1), transcript variant 1, mRNA 87 24/05/06,15735 speci gp,378 -379- ICHomo sapiens putative G protein coupled 5.12 Down 2.13E-04 BC0671 0 receptor, mRNA (cDNA clone MGC:71222 6 IMAGE:6645890), complete cds Homo sapiens neurofibromin 2 (bilateral 5.12 Down 1.99E-03 NM_1818 acoustic neuroma) (NF2), transcript variant 28 mRNA Homo sapiens GDNF family receptor alpha 1 5.11 Down 4.23E-05 NM_0052 (GFRA1I), transcript variant 1, mRNA 64 ICHomo sapiens cDNA FLJ34838 fis, clone 5.11 Down 6.46E-05 AK09215 NT2NE2010654 C-I 7 Homo sapiens chromosome 2 open reading 5.09 Down 5.42E-05 NM_0229 frame 23 (C2orf23), mRNA 12 Homo sapiens similar to hypothetical protein 5.09 Down 1 .38E-04 NM_0529 FLJ 10883 (L0C1 15294), mRNA 37 UI-E-CQ1 -aex-n-03-0-UI.sl UI-E-CQ 1 Homo 5.08 Down 3.24E-04 BM66545 sapiens cDNA clone UI-E-CQ1-aex-n-03-0-UI 3, 2 mRNA sequence Homo sapiens RIO kinase 3 (yeast) (RIOK3), 5.08 Down 1.64E-04 NM_0038 transcript variant 1, mRNA 31 Homo sapiens neuronatin (NNAT), transcript 5.08 Down 7.40E-06 NM_1 816 variant 2, mRNA 89 Homo sapiens, clone IMAGE:2960615, mRNA 5.07 Down 3.52E-05 BC0331 2 4 Homo sapiens WI P149-like protein 2 5.07 Down 6.36E-03 NM_0160 (DKFZP434J 154), transcript variant 2, mRNA 24/05/06,15735 speci bp,379 380 03 Homo sapiens, clone IMAGE:3446976, mRNA 5.06 Down 2.32E-04 BC03855 6 cr47c06.xl Human bone marrow stromal cells 5.06 Down 2.08E-03 AW0695 Homo sapiens cDNA clone HBMSC-cr47c06 3, 77 mRNA sequence Homo sapiens butyrylcholinesterase (BCHE), 5.05 Down 1 .20E-05 NM_0000 mRNA Homo sapiens claudin 11 (oligodendrocyte 5.04 Down 7.46E-04 NM_0056 transmembrane protein) (CLONl11), mRNA 02 Homo sapiens likely ortholog of rat SNE 1/AMP- 5.03 Down 8.60E-05 NM_0309 activated protein kinase (SNARK), mRNA 52 Homo sapiens cDNA FLJ35060 fis, clone 5.03 Down 1 .67E-05 AK09237 OCBBF2018828 9 Homo sapiens cDNA FLJ37694 fis, clone 5.01 Down 1.87E-04 AK09501 BRHIP201 5224 3 Homo sapiens chordin-like 1 (CHRDL1), mRNA 5.01 Down 1. 11 NM_1452 34 Homo sapiens similar to RIKEN cDNA 5 Down 9.27E-05 NM_1992 31100231302 (MGC16597), mRNA 87 Homo sapiens RABi 1 family interacting protein 5 Down 4.32E-05 NM_0251 1 (class 1) (RABilFIFPi), transcript variant 1, 51 mRNA 24/05/06,15735 speci gp,380 -381 TABLE VII G: GENES THAT WERE DIFFERENTIALLY EXPRESSED AT LEAST 5 FOLD IN AF-11 VERSUS AF-III CELLS Gene Gene Name Average fold Direction adj. p- Identifier change AF-11 value vs AF-1ll Homo sapiens zinc finger protein, Y-linked 328.28 Up 1 .97E-06 NM_0034 (ZFY), mRNA 11 Homo sapiens copine VIII (CPNE8), mRNA 286.5 Up 6.16E-06 NM_1536 34 H70730 yu69elO.rl Weizmann Olfactory Epithelium 272.44 Up 1.97E-06 Homo sapiens cONA clone IMAGE:239082 mRNA sequence Homo sapiens ribosomal protein S4, Y- 265.55 Up 1.56E-06 NM_1389 linked 2 (RPS4Y2), mRNA 63 Homo sapiens Smcy homolog, Y-linked 246.17 Up 1.OOE-06 NM_0046 (mouse) (SMVCY), mRNA 53 Homo sapiens DEAD (Asp-Glu-Ala-Asp) 244.93 Up 1.17E-05 NM_0046 box polypeptide 3, Y-Iinked (DDX3Y), mRNA Homo sapiens erythrocyte membrane 207.61 Up 1 .83E-06 NM_01 23 protein band 4. 1-like 3 (EPB41L13), mRNA 07 BX089554 Soares placenta Nb2HP Homo 119.7 Up 2.95E-06 BX08955 sapiens cDNA clone IMAGp998P07210; 4 IMAGE:142326, mRNA sequence Homo sapiens ribosomal protein S4, Y- 112.79 Up 2.02E-05 24/05/06,15735 speci gp.381 382 NM_0010 linked 1 (RPS4Y1), mRNA 08 Homo sapiens neuroligin 4, Y-linked 93.96 Up 9.61 E-06 NM_0148 (NLGN4Y), mRNA 93 Homo sapiens hypothetical protein 71.46 Up 1.36E-05 NM_1 827 FLJ39155 (FLJ391 55), transcript variant 2, 98 mRNA Homo sapiens unc-5 homolog D 48.16 Up 5.41 NM_0808 elegans) (UNC51D), mRNA 72 Homo sapiens mRNA; cDNA 47.84 Up 2.95E-06 BX64864 DKFZp686O1 7106 (from clone 3 DKFZp686O17106) Homo sapiens regulator of G-protein 47.75 Up 2.99E-05 NM_0029 signalling 16 (RGS 16), mRNA 28 Homo sapiens mRNA for KlAA1 384 protein, 45.54 Up 7.68E-06 AB03780 partial cds Homo sapiens membrane component, 44.02 Up 5.15E-05 NM_0318 chromosome 17, surface marker 2 (ovarian 62 carcinoma antigen CAl 25) (M17S2), transcript variant 3, mRNA UI-H-FH1-bfh-k-22-0-Ul.sl 43.87 Up 2.90E-06 CA42913 NCICGAPEHi Homo sapiens cONA clone UI-H-FH1-bfh-k-22-0-UI 3, mRNA sequence Homo sapiens, clone IMAGE:6155889, 42.03 Up 6.97E-06 BC04341 mRNA 1 Homo sapiens eukaryotic translation 41.7 Up 2.24E-04 NM_0046 initiation factor 1A, Y-linked (EIF1AY), 24/05/06,15735 speci gp.382 383 81 mRNA Homo sapiens chromosome 18 open 39.6 Up 9.61 E-06 NM_1814 reading frame 1 (Cl 8orfl), transcript variant 81 all,mRNA hw22f09.xl NCICGAPKidli Homo 39.51 Up 1.50E-05 BE46576 sapiens cONA clone IMAGE:31 83689 3, 0 mRNA sequence Homo sapiens phospholamban (PLN), 37.56 Up 1.87E-05 NM_0026 mRNA 67 Homo sapiens cONA FLJ40752 fis, clone 34.71 Up 1 .02E-04 AK09807 TRACH2000972 1 Homo sapiens cytochrome c oxidase 33.43 Up 1 .08E-06 NM_0018 subunit Vila polypeptide 1 (muscle) 64 (COX7A1), mRNA Homo sapiens short form transcription 32.71 Up 9.41 E-04 AF05537 factor C-MAF (c-maf) mRNA, complete cds 6 Homo sapiens cadherin 6, type 2, K- 31.51 Up 1.37E-05 NM_0049 cadherin (fetal kidney) (CDH6), mRNA 32 Homo sapiens neuro-oncological ventral 30.4 Up 1.97E-06 NM_0025 antigen 1 (NOVAlI), transcript variant 1, mRNA Homo sapiens multiple C2-domains with 29.49 Up 1 .68E-05 NM_0183 two transmembrane regions 2 (MCTP2), 49 mRNA Homo sapiens ribosomal protein L27a 28.23 Up 4.25E-04 NM_0009 (RPL27A), mRNA BX1 11353 NCICGAPKid3 Homo sapiens 27.4 Up 3.27E-06 24/05/06,15735 speci gp. 383 -384- BX1 1135 cDNA clone IMAGp9980094576; 3 IMAGE: 1869152, mRNA sequence Homo sapiens chromosome Y open 27.08 Up 3.1 OE-06 NM_0325 reading frame 15B (CYorfl5B), mRNA 76 (N Homo sapiens left-right determination factor 26.55 Up 1 .42E-05 NM_-0209 1 (LEFTYl), mRNA 97 Homo sapiens anterior gradient 2 homolog 25.93 Up 2.36E-05 NM_0064 (Xenopus laevis) (AGR2), mRNA 08 AGENCOURT_8840265 24.29 Up 2.OOE-06 BQ92483 Lupski sciatic-nerve Homo sapiens cODNA 2 cione IMAGE:6205036 5, mRNA sequence Homo sapiens hypothetical protein 23.73 Up 7.1 NM_0190 FLJ20152 (FLJ2O1 52), mRNA 00 Homo sapiens hypothetical protein 23.25 Up 1 .82E-06 BC03565 L0C285835, mRNA (cDNA clone 6 IMAGE:5588650), partial cds owl 3g03.xl 22.96 Up 5.20E-06 A1032876 Soares-parathyroid_tumorNbHPA Homo sapiens cIDNA clone IMAGE: 1646740 3, mRNA sequence Homo sapiens claudin 4 (CLDN4), mRNA 21.95 Up 3.72E-04 NM_0013 BX089554 Soares placenta Nb2HP Homo 20.73 Up 2.OOE-06 BX08955 sapiens cODNA clone IMAGp998P07210; 4 IMAGE: 142326, mRNA sequence UI-HF-BNO-ane-d-05-0-UI.rl NIHMGC_50 20.24 Up 7.57E-05 CF13754 Homo sapiens cONA clone 24/05/06,15735 speci gp,384 385 IMAGE:3092384 5, mRNA sequence NISC-gfO8fO3.xl NCICGAPKidl2 Homo 20.2 Up 4.77E-06 CB804709 sapiens clDNA clone IMAGE:325301 3 3, 2 mRNA sequence Homo sapiens heparan sulfate 19.91 Up 2.92E-05 NM_0051 (glucosamine) 3-0-sulfotransferase 1 14 (HS3ST1), mRNA AGENCOURT_7776027 NIHMGC_68 19.78 Up 9.59E-04 BQ43078 Homo sapiens cDNA clone 8 IMAGE:6024295 5, mRNA sequence Homo sapiens cDNA FLJ 14176 fis, clone 19.33 Up 2.32E-05 AK02423 NT2RP20031O1 8 Homo sapiens mitochondrial tumor 18.91 Up 2.90E-06 NM_001 0 suppressor 1 (MTUS1), nuclear gene 01931 encoding mitochondrial protein, transcript variant 4, mRNA Homo sapiens melanoma associated 18.66 Up 1.97E-06 NM_1524 antigen (mutated) 1-like 1 (MUMi1-l), 23 mRNA BX1 13590 Soares-fetal-heartNbHH1 9W 18.22 Up 3.83E-05 BX1 1359 Homo sapiens cDNA clone 0 IMAGp998A14871 ;IMAGE:376597, mRNA sequence Homo sapiens neuronal PAS domain 17.82 Up 3.88E-05 NM_0025 protein 2 (NPAS2), mRNA 18 Homo sapiens cONA FLJ46882 fis, clone 17.2 Up 1. 17E-03 AK12871 UTERU3015844 nxl3bO2.sl NClCGAPGC3 Homo 16.61 Up 6.24E-06 AA73825 sapiens cDNA clone IMAGE: 1255947 3, 24/05/06,15735 speci gp.385 -386- 4 mRNA sequence Homo sapiens vasoactive intestinal peptide 16.44 Up 5.33E-06 NM_0033 (VIP), transcript variant 1, mRNA 81 wv38h09.xl NCICGAP_0v18 Homo 14.99 Up 6.49E-03 A1951740 sapiens cIDNA clone IMAGE:2531873 3, mRNA sequence Homo sapiens nebulette (NEBL), transcript 14.87 Up 1.84E-03 NM 0063 variant 1, mRNA 93 Homo sapiens prostag land in-e ndoperoxide 14.83 Up 3.02E-03 NM_0009 synthase 2 (prostaglandin G/H synthase 63 and cyclooxygenase) (PTGS2), mRNA H89053 yw24c06.rl Morton Fetal Cochlea Homo 14.76 Up 6.87E-03 sapiens cDNA clone IMAGE:253162 mRNA sequence 086975 Homo sapiens mRNA for KIAA0222 gene, 14.7 Up 2.87E-04 partial cds zn26a04.si Stratagene neuroepithelium 13.56 Up 2.86E-04 AA1 0255 NT2RAMI 937234 Homo sapiens cDNA 3 clone IMAGE:548526 3, mRNA sequence Homo sapiens cIDNA FLJ39389 fis, clone 13.38 Up 2.90E-05 AK09670 PLACE6003621 8 Ul-E-EJ1-ajl--1 3-0-Ulsi UI-E-EJ1 Homo 12.74 Up 2.49E-04 BM6851 2 sapiens cIDNA clone UI-E-EJ -ajl-l-1 4 3, mRNA sequence qg84dOl xl SoaresNFLTGBCSi 12.47 Up 1.90E-04 A1220066 Homo sapiens clDNA clone IMAGE:1841857 3, mRNA sequence qt26g09.xl 12.29 Up 7.15E-04 A1342246 Soares-pregnant uterusNbHPU Homo 24/05/06,15735 speci gp. 3 86 387 IND sapiens cIDNA clone IMAGE: 1949152 3, mRNA sequence Homo sapiens homeo box D1 (HOXD1), 12.11 Up 9.73E-06 NM_0245 mRNA 01 Homo sapiens paired related homeobox 2 12 Up 9.50E-04 NM_0163 (PRRX2), mRNA 07 Homo sapiens mRNA for KIAA0884 protein, 11.69 Up 1 .47E-04 AB02069 partial cds IND 601174523F1 NIHMGC_1 7 Homo sapiens 11.64 Up 1.47E-03 BE29546 cIDNA clone IMAGE:3529924 5, mRNA 8 sequence in6OaO5.x3 HR85 islet Homo sapiens cIDNA 11.37 Up 3.28E-05 BU95146 clone IMAGE:6126249 3, mRNA sequence 9 Homo sapiens transcription factor CP2-Iike 11.26 Up 3.35E-05 NM_1 981 4 (TFCP2L4), transcript variant 3, mRNA 74 Homo sapiens matrix metal loproteinase 1 11.12 Up 5.10E-04 NM_0024 (interstitial collagenase) (MMP1), mRNA 21 Homo sapiens RasGEF domain family, 10.64 Up 2.38E-05 NM_1453 member 1A (RASGEF1A), mRNA 13 Homo sapiens nuclear receptor subfamily 10.62 Up 3.93E-06 NM_0009 3, group C, member 2 (NR3C2), mRNA 01 AL552527 Homo sapiens PLACENTA COT 10.61 Up 3.88E-03 AL55252 25-NORMALIZED Homo sapiens cODNA 7 clone CSOD1067YL24 3-PRIME, mRNA 24/05/06,15735 speci gp,387 388 sequence Homo sapiens cysteine and tyrosine-rich 1 10.58 Up 7.22E-05 NM_0529 (CYYR1), mRNA 54 Homo sapiens noncoding mRNA sequence 10.39 Up 1.49E-04 AF51 962 2 (iHomo sapiens neuromedin U (NMU), 10.37 Up 2.92E-05 NM_0066 mRNA 81 W93585 zd95gOl.sl Soares-fetal-heartNbHH19W 10.27 Up 2.01 E-04 Homo sapiens cODNA clone IMAGE:357264 3, mRNA sequence BX1 05152 Soares-testisNHT Homo 9.89 Up 4.37E-05 BX10515 sapiens cIDNA clone I MAGp998J212575; 2 IMAGE: 1031156, mRNA sequence AV709232 ADC Homo sapiens cONA clone 9.89 Up 1 .56E-04 AV70923 ADCAJB1 1 5, mRNA sequence 2 W69644 zd4SflO.rl Soares-fetal-heartNbHH19W 9.89 Up 1.90E-05 Homo sapiens cIDNA clone IMAGE:343627 mRNA sequence Homo sapiens cellular retinoic acid binding 9.82 Up 2.65E-04 NM_0018 protein 2 (CRABP2), mRNA 78 Homo sapiens sema domain, 9.78 Up 6.57E-04 NM_1527 immunoglobulin domain short basic 54 domain, secreted, (semaphorin) 3D (SEMA31D), mRNA 601486331 Fl NIHMGC_69 Homo sapiens 9.59 Up 1.90E-04 BE87776 cONA clone IMAGE:3888943 5, mRNA 4 sequence 24/05/06,15735 speci gp.388 389 Homo sapiens cDNA: FLJ22256 fis, clone 9.52 Up 8.65E-05 AK02590 HRC02860 9 Homo sapiens SET binding protein 1 9.3 Up 3.69E-04 NM_0155 (SETBP1), mRNA 59 tg7OfO4.xl SoaresNhHMPuSi Homo 9.21 Up 1.86E-05 A1493349 sapiens cDNA clone IMAGE:21 14143 3, mRNA sequence Homo sapiens cDNA FLJ26445 fis, clone 9.2 Up 1.41 E-04 AK12995 KDN02608 BX098521 Soares fetal liver spleen 1 NFLS 9.06 Up 9.68E-04 BX09852 Homo sapiens cDNA clone 1 IMAGp998L05118; IMAGE:123412, mRNA sequence Homo sapiens cDNA FLJ36973 fis, clone 9.05 Up 3.44E-05 AK09429 BRACE2006249 2 Homo sapiens cDNA FLJ38457 fis, clone 8.98 Up 1.13E-05 AK09577 FEBRA2020400 6 Homo sapiens hypothetical protein 8.98 Up 8.02E-04 NM_0182 FLJ10847 (FLJ10847), mRNA 42 wsl5dO4.xl NCICGAPKidil Homo 8.93 Up 1.50E-05 AW0068 sapiens cONA clone IMAGE:2497255 3, 64 mRNA sequence BX103846 NCICGAPLu24 Homo 8.89 Up 1.38E-04 BX1 0384 sapiens cDNA clone IMAGp998F1 25811; 6 IMAGE:2342027, mRNA sequence Homo sapiens desmocollin 2 (DSC2), 8.84 Up 3.19E-05 24/05/06,15735 speci gp. 389 -390- NM_0244 transcript variant Dsc2a, mRNA 22 Homo sapiens protein kinase (cAMP- 8.77 Up 1.35E-03 NM_0324 dependent, catalytic) inhibitor beta (PKIB), 71 transcript variant 3, mRNA Homo sapiens cODNA FLJ42788 fis, clone 8.62 Up 4.29E-04 AK12477 BRAWH3007129 8 H25898 y155b10.r1 Soares breast 3NbHBst Homo 8.52 Up 1.29E-04 sapiens cODNA clone IMAGE: 162139 mRNA sequence Homo sapiens leucine rich repeat 8.5 Up 3.01 E-03 NM_0155 transmembrane neuronal 2 (LRRTM2), 64 mRNA qb95d06.xl Soares-fetal-heartNbHH19W 8.5 Up 6.30E-05 A1126888 Homo sapiens cIDNA clone IMAGE: 1707851 3, mRNA sequence Homo sapiens, clone IMAGE:4794726, 8.46 Up 3.65E-02 BC04202 mRNA 8 Homo sapiens CUG triplet repeat, RNA 8.37 Up 2.52E-03 NM_0065 binding protein 2 (CUGBP2), mRNA 61 Homo sapiens ras homolog gene family, 8.36 Up 4.99E-04 NM_0046 member I (ARHI), mRNA hz3SgOl.xl NCICGAPGC6 Homo 8.3 Up 1.OOE-05 BE50391 sapiens cONA clone IMAGE:3210000 3, 6 mRNA sequence Homo sapiens hypothetical gene supported 8.28 Up 2.72E-05 NM_2074 by AK075564; BC060873 (L0C400451), 46 mRNA 24/05/06,15735 speci gp,390 -391 Homo sapiens cDNA FLJ34412 fis, clone 8.08 Up 9.36E-05 AK091 73 HEART2002432 1 Homo sapiens killer cell lectin-like receptor 8.07 Up 2.69E-04 NM_0022 subfamily C, member 3 (KLRC3), transcript 61 variant NKG2-E, mRNA NCICGAPKidil Homo 7.99 Up 4.03E-05 AW2709 sapiens cDNA clone IMAGE:2768840 3, 28 mRNA sequence Homo sapiens tumor protein 052 (TPD52), 7.97 Up 4.79E-05 NM_0050 mRNA 79 Homo sapiens aldo-keto reductase family 1, 7.88 Up 3.67E-04 NM_001 3 member C1 (dihydrodiol dehydrogenase 1; 53 20-alpha (3-alpha)-hydroxysteroid dehydrogenase) (AKR1C1), mRNA wh52c02.xl NCICGAPKidil Homo 7.82 Up 1.23E-03 A1830524 sapiens cDNA clone IMAGE:2384354 3, mRNA sequence Homo sapiens mRNA; cDNA 7.82 Up 9.59E-04 BX64820 DKFZp686E16168 (from clone 7 DKFZp686E16168) wy76d 11 xi1 7.79 Up 4.64E-05 AW0437 SoaresNSFF8_9WOTPAPSi Homo 93 sapiens cDNA clone IMAGE:2554485 3 similar to contains element MER18 repetitive element;, mRNA sequence N63415 yy6OdO4.sl 7.76 Up 1.14E-03 Soares-multiple sclerosis_2NbHMSP Homo sapiens cDNA clone IMAGE:277927 3 similar to contains L1.b3 Li repetitive element;, mRNA sequence Homo sapiens killer cell lectin-like receptor 7.76 Up 3.65E-04 24/05106,15735 speci gp.391 392 NM_0022 subfamily C, member 2 (KLRC2), mRNA Homo sapiens chromosome I open reading 7.75 Up 5.34E-04 NM_0048 frame 38 (Clorf38), mRNA 48 Homo sapiens leucine rich repeat 7.53 Up 3.35E-05 NM_0249 transmembrane neuronal 4 (LRRTM4), 93 mRNA ne08e05.y5 NCICGAPCo3 Homo 7.51 Up 5.58E-04 A1821210 sapiens clDNA clone IMAGE:880640 mRNA sequence U l-E-CLl -afa-p-05-0-Ul.sl UI-E-CLl Homo 7.4 Up 5.30E-04 BM66444 sapiens clDNA clone UI-E-CL1-afa-p-05-0- UI 3, mRNA sequence Homo sapiens ankyrin repeat domain 7 7.39 Up 2.24E-04 NM_0196 (ANKRD7), mRNA 44 UI-H-FL1-bfx-d-10-0-UI.sl NCICGAPELI 7.35 Up 1.13E-05 BU62079 Homo sapiens cDNA clone UI-H-FL1-bfx-d- 3 10-0-Ul 3, mRNA sequence Homo sapiens potassium channel, 7.31 U p 1.68E-05 NM_0022 subfamily K, member 3 (KCNK3), mRNA 46 Homo sapiens transmembrane 4 7.13 Up 2.31 E-03 NM_0314 superfamily member 10 (TM4SF1 mRNA 42 BX092501 NCICGAPLu5 Homo sapiens 7.12 Up 1.69E-03 BX09250 cDNA clone IMAGp998K143946; 1 IMAGE: 1557637, mRNA sequence Homo sapiens armadillo repeat containing, 7.09 Up 9.21 E-03 NM_1779 X-linked 2 (ARMCX2), mRNA 49 24/05/06.15735 speci gp. 39 2 393 Homo sapiens nipsnap homolog 3B 7.03 Up 2.53E-02 NM_0183 elegans) (NIPSNAP3B3), mRNA 76 Homo sapiens cDNA FLJ36443 fis, clone 7.02 U p 1.23E-03 AK09376 THYMU2012891 2 Homo sapiens potassium inwardly- 7.01 Up 6.28E-04 NM_0186 rectifying channel, subfamily J, member 16 58 (KCNJ16), transcript variant 1, mRNA Homo sapiens mRNA for KIAA1 119 protein, 6.98 Up 1. 11 E-04 AB03294 partial cds Homo sapiens ferritin, heavy polypeptide- 6.97 Up 3.42E-03 NM_0318 like 17 (FTHL17), mRNA 94 UI-H-B-aee-a-12-0-UI.sl 6.96 Up 3.35E-05 AW1398 NCICGAPSub3 Homo sapiens cONA 91 clone IMAGE:2719006 3, mRNA sequence Homo sapiens cDNA FLJ42571 fis, clone 6.9 Up 2.57E-05 AK12456 BRACE3008036 2 Homo sapiens dipeptidylpeptidase 4 6.9 Up 1 .08E-03 NM_001 9 (CD26, adenosine deaminase complexing protein 2) (DPP4), mRNA tu35d06.xl NCICGAPPr28 Homo 6.87 Up 4.03E-06 A1686652 sapiens cONA clone IMAGE:2253035 3, mRNA sequence Homo sapiens tripartite motif-containing 55 6.85 Up 1.68E-05 NM_1 840 (TRIM55), transcript variant 4, mRNA 87 Homo sapiens chemokine (C-X-C motif) 6.81 U p 9.44E-05 NM_0020 ligand 2 (CXCL2), mRNA 24/05/06,15735 speci gp,393 394 89 Homo sapiens period homolog 3 6.81 U p 6.24E-06 NM_0168 (Drosophila) (PER3), mRNA 31 Homo sapiens neuro-oncological ventral 6.79 Up 4.79E-05 NM_0025 antigen 1 (NOVAI), transcript variant 1, mRNA Homo sapiens, clone IMAGE:3881549, 6.77 Up 1.84E-02 BC01290 mRNA 0 Homo sapiens zinc finger protein 452 6.75 Up 2.98E-03 NM_0529 (ZNF452), mRNA 23 Homo sapiens DnaJ (Hsp4O) homolog, 6.73 Up 5.46E-04 NM_0218 subfamily C, member 12 (DNAJC12), 00 transcript variant 1, mRNA Homo sapiens cDNA FLJ32320 fis, clone 6.71 U p 9.55E-04 AK05688 PROST2003537 2 602128672F1 NIHMGC_56 Homo sapiens 6.7 Up 4.03E-06 BF70068 cONA clone IMAGE:4285673 5, mRNA 4 sequence Homo sapiens hypothetical protein 6.66 Up 1.64E-03 NM_1446 MGC33371 (MGC33371), mRNA 64 Homo sapiens mRNA; cDNA 6.62 Up 8.14E-05 AL83277 DKFZp686H 157 (from clone 9 DKFZp686H157) Homo sapiens chondroitin betal ,4 N- 6.6 Up 6.54E-04 NM_0183 acetylgalactosaminyltransferase (ChGn), 71 mRNA Homo sapiens transmembrane 4 6.56 Up 9.52E-03 24/05/06.15735 speci gp.394 395 NM_0143 superfamily member 13 (TM4SF13), mRNA 99 nyO6hlO.sl NCICGAPGCB1 Homo 6.54 Up 3.49E-03 AA74876 sapiens cONA clone IMAGE: 127101 1 3, 2 mRNA sequence Homo sapiens clone HB-2 mRNA sequence 6.5 Up 4.90E-05 AF21 607 7 zk49f07.sl 6.49 Up 5.44E-04 AA04325 Soares-pregnant uterusNbHPU Homo sapiens clDNA clone IMAGE:486 181 3, mRNA sequence Homo sapiens chromosome 20 open 6.44 Up 2.32E-03 NM_1528 reading frame 58 (C20orf58), mRNA 64 Homo sapiens cingulin-like 1 (CGNL1), 6.4 Up 3.69E-03 NM_0328 mRNA 66 Homo sapiens cDNA FLJ30428 fis, clone 6.37 Up 3.89E-05 AK05499 BRACE2008941 0 Homo sapiens endothelial cell adhesion 6.35 Up 2.70E-04 NM_1389 molecule (ESAM), mRNA 61 aj93h05.xl NCICGAPKid3 Homo 6.27 Up 3.90E-05 A1244954 sapiens cONA clone IMAGE: 1867065 3, mRNA sequence Homo sapiens neuronal guanine nucleotide 6.25 Up 4.99E-04 NM_01 98 exchange factor (NGEF), mRNA Homo sapiens nidogen 2 (osteonidogen) 6.15 Up 7.03E-03 NM_0073 (NID2), mRNA 24/05/06,15735 speci gp.395 -396- 61 Homo sapiens glycine dehydrogenase 6.13 Up 2.12E-05 NM_0001 (decarboxylating; glycine decarboxylase, glycine cleavage system protein P) (GLDC), mRNA 602592506F1 NIHMGC_79 Homo sapiens 6.09 Up 1.13E-05 BG57203 cDNA clone IMAGE:4719888 5, mRNA 9 sequence Homo sapiens calcitonin receptor-like 6.03 Up 3.13E-02 NM_0057 (CALCRL), mRNA ij94e04.xl Human insulinoma Homo 6.02 Up 6.53E-04 BQ26780 sapiens cONA clone IMAGE:5779278 3, 6 mRNA sequence Homo sapiens, clone IMAGE:5272183, 6 Up 3.15E-04 BC03622 mRNA 3 Homo sapiens collagen, type XII, alpha 1 5.96 Up 1.14E-02 NM_0043 (COL1 2A1), transcript variant long, mRNA Homo sapiens v-maf musculoaponeurotic 5.95 Up 2.41 E-03 NM_0053 fibrosarcoma oncogene homolog (avian) (MAE), mRNA Homo sapiens mRNA for KIAA1 222 protein, 5.94 Up 3.49E-04 AB03304 partial cds 8 Homo sapiens hypothetical protein 5.93 Up 2.24E-04 NM_0177 FLJ20366 (FLJ20366), mRNA 86 xu9lgll1.xl NCICGAPUt2 Homo sapiens 5.92 Up 1. 11 E-04 AW5151 cDNA clone IMAGE:2809124 3, mRNA 14 sequence 24/05/06,15735 speci gp,396 -397- Homo sapiens cDNA FLJ25677 fis, clone 5.84 Up 4.99E-03 AK09854 TST04054 3 Homo sapiens Kruppel-like factor 4 (gut) 5.83 Up 6.54E-04 NM_0042 (KLF4), mRNA c-I tb29h06.xi NCI_CGAP_Kidi2 Homo 5.81 U p 1.24E-04 A1335277 sapiens cDNA clone IMAGE:2055803 3, mRNA sequence Homo sapiens cDNA FLJ37685 fis, clone 5.76 Up 3.79E-03 AK09500 BRHIP2013972 c-I 4 UI-H-Eli-azc-k-08-0-UI.si NCICGAPEli 5.68 Up 1.24E-04 BQ00715 Homo sapiens cONA clone 6 IMAGE:58469111 3, mRNA sequence Homo sapiens adducin 3 (gamma) (ADD3), 5.68 Up 6.3211-04 NM_0168 transcript variant 1, mRNA 24 ou33h05.si SoaresNFLTGBCSi 5.67 Up 9.57E-05 AA99433 Homo sapiens cONA clone 0 IMAGE:i628i2i1 3, mRNA sequence Homo sapiens Fi 1 receptor (F1 i 5.65 Up 7.59E-05 NM_0169 transcript variant 1, mRNA 46 Homo sapiens G protein-coupled receptor 5.63 Up 7.59E-05 NM_0053 kinase 5 (GRK5), mRNA 08 6024i3981iF1 NIHMGC_92 Homo sapiens 5.6i U p 1.31 E-04 BG38932 cDNA clone IMAGE:4522269 5, mRNA 8 sequence 17000600077294 GRNPREHEP Homo 5.57 Up 1.94E-02 CN371 16 sapiens cONA 5, mRNA sequence 24/05/06,15735 speci Sp,39 7 398 8 Homo sapiens cONA FLJ 11469 fis, clone 5.56 Up 7.81 E-03 AK02153 HEMBA1001658 1 Homo sapiens collagen, type IX, alpha 3 5.56 Up 6.94E-05 NM_0018 (COL9A3), mRNA 53 Homo sapiens cONA clone 5.56 Up 9.99E-04 BC03792 IMAGE:5284659, partial cds 9 SoaresNhHMPuSi Homo 5.54 Up 1.20E-03 A1086279 sapiens clDNA clone IMAGE: 1677841 3, mRNA sequence 7q53g05.xl NCICGAPLu24 Homo 5.48 Up 1.23E-04 BF43347 sapiens clDNA clone IMAGE:3702320 3 9 similar to TR:Q9Y7P8 Q9Y7P8 HYPOTHETICAL 11.7 KID PROTEIN.;, mRNA sequence ov68h06.xl Soares-testisNHT Homo 5.46 Up 1.59E-04 A1024717 sapiens cODNA clone IMAGE: 1642523 3, mRNA sequence Homo sapiens cytokine induced protein 29 5.45 Up 9.59E-04 NM_0330 kDa (CIP29), mRNA 82 W56431 zc57f06.rl 5.42 Up 3.76E-04 Soares-parathyroid-tumorNbHPA Homo sapiens cONA clone IMAGE:326435 mRNA sequence Homo sapiens chromosome 10 open 5.41 U p 1.47E-04 NM_1445 reading frame 87 (ClOorf87), mRNA 87 BX101489 SoaresNFLTGBCSi Homo 5.37 Up 1.71 BX10148 sapiens cONA clone IMAGp998O165825; 24/05/06.15735 speci gp, 398 -399- 9 IMAGE:2347623, mRNA sequence Homo sapiens response gene to 5.32 Up 1 .48E-04 NM_0140 complement 32 (RGC32), mRNA 59 tm62e06.x5 NCI_CGAP_Brn25 Homo 5.3 Up 1.84E-03 A1939617 sapiens cONA clone IMAGE:2162722 3, mRNA sequence Homo sapiens Epstein-Barr virus induced 5.3 Up 8.80E-04 NM_0049 gene 2 (lymphocyte-specific G protein- 51 coupled receptor) (EBI2), mRNA Homo sapiens cDNA FLJ37734 fis, clone 5.3 Up 2.53E-04 AK09505 BRHIP2020842 3 Homo sapiens phospholipase A2, group 5.3 Up 1.56E-02 NM_0244 IVA (cytosolic, calcium-dependent) (PLA2G4A), mRNA Homo sapiens hypothetical protein 5.29 Up 2.12E-05 NM_0180 FLJ10159 (FLJ1O159), mRNA 13 BX101850 Soares infant brain iNIB Homo 5.25 Up 7.59E-05 BX1 0185 sapiens cDNA clone IMAGp998M141 39; 0 IMAGE:26298, mRNA sequence C18094 C18094 Human placenta cDNA (TFujiwara) 5.23 Up 1.OOE-05 Homo sapiens cDNA clone GEN-557007 mRNA sequence UI-H-FL1 -bgx-k-02-0-UI .sl 5.22 Up 2.86E-04 BU63433 NCI_OGAP_FLi Homo sapiens cONA 2 clone UI-H-FL1-bgx-k-02-0-UI 3, mRNA sequence owl 0e02.xl 5.18 Up 4.89E-03 A1033863 Soares_parathyroid-tumorNbHPA Homo sapiens cONA clone IMAGE: 1646426 3, 24/05/06,15735 speci gp,399 400 mRNA sequence 602591134F1 NIHMGC_77 Homo sapiens 5.18 Up 4.36E-04 BG57014 cONA clone IMAGE:4717761 5, mRNA 4 sequence Homo sapiens RRN3 RNA polymerase 1 5.17 Up 1.68E-03 N M_0184 transcription factor homolog (yeast) 27 (RRN3), mRNA DKFZp686J07250_ri 686 (synonym: hlcc3) 5.14 Up 1.31 E-03 BX48620 Homo sapiens cIDNA clone 8 DKFZp686J07250 5, mRNA sequence Homo sapiens ectonucleotide 5.14 Up 3.43E-04 NM_0149 pyrophosphatase/phosphodiesterase 4 36 (putative function) (ENPP4), mRNA Homo sapiens full length insert cODNA clone 5.14 Up 4.OOE-04 AF08613 ZA88B306 4 Homo sapiens collagen, type IV, alpha 6 5.12 Up 1.03E-03 NM_001 8 (COL4A6), transcript variant A, mRNA 47 Homo sapiens cDNA FLJ38407 fis, clone 5.1 Up 1.35E-04 AK09572 FEBRA2008859 6 UI-1-BC1p-alg-a-03-O-UI.sl 5.09 Up 1.42E-05 BQ01 386 NCICGAPP13 Homo sapiens cDNA clone 9 UI-1-BC1p-alg-a-03-0-UI 3, mRNA sequence Homo sapiens attractin-like 1 (ATRNL-1), 5.04 Up 4.36E-04 NM_2073 mRNA 03 NISC-ggOl hOl.yl NCICGAPKidli1 5.04 U p 1. 16E-03 CB04728 Homo sapiens cODNA clone 7 IMAGE:3253464 5, mRNA sequence 24/05/06,15735 speci gp,400 -401- Homo sapiens matrix metalIloprotei nase 7 NM_0024 (matrilysin, uterine) (MMP7), mRNA 23 xq93c06.xl NCICGAPBrn53 Homo AW2626 sapiens cDNA clone IMAGE:2758186 3, 83 mRNA sequence Homo sapiens transgelin 3 (TAGLIN3), NM_01 32 transcript variant 1, mRNA 59 D52654 HUMO84DO2B Clontech human fetal brain polyA+ mRNA (#6535) Homo sapiens cDNA clone GEN-084002 5, mRNA sequence Homo sapiens periostin, osteoblast specific NM_0064 factor (POSTIN), mRNA Homo sapiens mab-21 -like 2 elegans) NM_0064 (MAB21L2), mRNA 39 Homo sapiens Ras interacting protein 1 NM_0178 (RASIPI), mRNA Homo sapiens nicotinamide N- NM_0061 methyltransferase (INNMT), mRNA 69 Homo sapiens mRNA for KIAA1912 protein, A806749 partial cds 9 Homo sapiens SRY (sex determining region NM_0070 Y)-box 21 (SOX21), mRNA 5.02 Up 5.02 Up 5.01 Up 6.94E-05 3.19E-05 8.63E-04 449.36 Down 293.88 Down 199.11 Down 153.9 Down 91.55 Down 69.67 Down 9.61 E-06 9.16E-05 3.53E-05 9.55E-05 1 .57E-05 1.13 55.37 Down 8.65E-05 Homo sapiens TatD DNase domain 52.52 Down 2.24E-04 24/05/06,15735 speci gp, 4 O1 402 NM_0320 containing 1 (TATONi), mRNA 26 Homo sapiens RNA (guanine-9-) NM_0178 methyltransferase domain containing 1 19 (RG9MTD1), mRNA Homo sapiens chromosome 20 open NM_0328 reading frame 100 (C20orflOO), mRNA 83 QV2-TN0173-021 100-454-g06 TN0173 BQ37571 Homo sapiens cDNA, mRNA sequence 9 Homo sapiens, clone IMAGE:5259432, BC03731 mRNA 6 Homo sapiens, clone IMAGE:5277693, BC04237 mRNA 8 Homo sapiens EGF-containing fibulin-like NM_0188 extracellular matrix protein 1 (EFEMPi), 94 transcript variant 2, mRNA -omo sapiens succinate receptor 1 NM_0330 (SUCNR1), mRNA Homo sapiens zinc finger, CCHC domain NM_1526 containing 5 (ZCCHC5), mRNA 94 Homo sapiens ankyrin repeat domain 30A NM_0529 (ANKRD3OA), mRNA 97 Homo sapiens cDNA: FLJ23131 fis, clone AK02678 LNG08502 4 47.78 Down 45.19 Down 44.03 Down 2.09E-04 8.58E-05 1.41 E-04 34.66 Down 2.12E-05 32.65 Down 6.44E-04 30.19 Down 2.74E-05 30.08 Down 29.85 Down 28.91 Down 27.95 Down 1 .95E-04 7.57E-05 5.75E-04 8.14E-05 24/05/06,15735 speci gp,402 -403- Homo sapiens crystallin, alpha B (CRYAB), NM_0018 mRNA Homo sapiens claudin 11 (oligodendrocyte NM_0056 transmembrane protein) (CLDN11), mRNA 02 Homo sapiens fatty acid binding protein 4, NM_0014 adipocyte (FABP4), mRNA 42 Homo sapiens potassium NM_0216 intermediate/small conductance calcium- 14 activated channel, subfamily N, member 2 (KCNN2), transcript variant 1, mRNA Homo sapiens cDNA FLJ41881 fis, clone AK12387 OCBBF2021833 R44402 yg37a01.s1 Soares infant brain 1NIB Homo sapiens cDNA clone IMAGE:34639 3 similar to contains MER35 repetitive element;, mRNA sequence Homo sapiens cDNA FLJ37694 fis, clone AK09501 BRHIP2015224 26.31 Down 23.71 Down 23.48 Down 5.48E-05 1.13E-05 4.05E-04 23.14 Down 9.61 E-06 22.73 Down 22.27 Down 9.17E-05 2.38E-05 20.95 Down 20.88 Down 9.77E-04 Homo sapiens interleukin 7 receptor (IL7R), mRNA 4.62E-04 NM_0021 Homo sapiens TP53TG3 protein NM_0162 (TP53TG3), mRNA 12 Homo sapiens hypothetical protein NM_1527 MGC33993 (MGC33993), mRNA 37 20.63 Down 6.56E-05 19.89 Down 6.16E-06 24/05/06,15735 speci gp.403 404 7h07e07.xl NCI_CGAP_Col6 Homo BF00248 sapiens cONA clone IMAGE:3315300 3, 9 mRNA sequence Homo sapiens hyd roxysteroid (11 -beta) NM_0055 dehydrogenase 1 (HSD1I111), transcript variant 1, mRNA Homo sapiens pp9974 mRNA, complete AF31838 cds 2 BX1 15825 Soares NhHMPu Si Homo BX11582 sapiens cDNA clone IMAGp998C134603; IMAGE: 1879236, mRNA sequence Homo sapiens insulin-like growth factor 2 NM_0006 (somatomedin A) (IGF2), mRNA 12 Homo sapiens cDNA FLJ34795 fis, clone AK0921 1 NT2NE2005921 4 ti7OaOl.xl NCl CGAP Kidil Homo A1469032 sapiens cDNA clone IMAGE:2137320 3, mRNA sequence Homo sapiens Rho GDP dissociation NM_001 1 inhibitor (GOI) beta (ARHGDIB), mRNA Homo sapiens clone 23688 mRNA AF05211 sequence hol 5fO6.yl Human Trabecular meshwork CD67733 cDNA: hohphq Homo sapiens cDNA clone 2 hol 5f06 5, mRNA sequence Homo sapiens RNA binding motif protein 28 NM_0180 (RBM28), mRNA 19.88 Down 18.27 Down 17.67 Down 8.65E-05 3. 53E-05 3.89E-05 17.5 Down 1.67E-04 16.41 Down 4.79E-05 16.29 Down 2.1 8E-05 15.92 Down 15.57 Down 9.36E-05 4.62E-05 15.11 Down 1.03E-04 14.89 Down 14.72 Down 8.06E-05 9.OOE-05 24105/06,15735 speci gp, 4 0 4 405 INO Ct Homo sapiens glycoprotein hormones, NM_0007 alpha polypeptide (CGA), mRNA N49730 yzO6al2.sl Soares-multiple sclerosis2NbHMSP Homo sapiens cDNA clone IMAGE:282238 3 similar to contains Alu repetitive element; contains element PTR5 repetitive element:, mRNA sequence Homo sapiens follistatin (FST), transcript NM_0063 variant FST317, mRNA Homo sapiens cDNA FLJ30956 fis, clone AK05551 HCASM2000202 14.51 Down 2.62E-04 13.53 Down 2.76E-05 13.34 Down 2.53E-04 13.09 Down 2.63E-03 13.04 Down 1.84E-02 Homo sapiens protein phosphatase methylesterase-1 (PME-1), mRNA NM_0161 47 Homo sapiens BH-protocadherin (brain- NM_0324 heart) (PCDH7), transcript variant c, mRNA 13.01 Down 12.94 Down 7.57E-05 BX64829 9 BC03431 AA1 9532 8 Homo sapiens mRNA; cDNA DKFZp686JO4 125 (from clone DKFZp686JO41 1.82E-04 Homo sapiens hypothetical protein L0C90529, mRNA (cONA clone IMAGE:4827425), containing frame-shift errors zr34f08.sl Soares NhHMPu Si Homo sapiens cDNA clone IMAGE:665319 3, mRNA sequence 12.94 Down 2.72E-04 12.73 Down 7.59E-04 24/05/06,15735 speci gp,405 .ffi 406 ox55c02.sl A1082507 Scares-total-fetusNb2HF8_9w Homo sapiens cDNA clone IMAGE: 1660226 3, mRNA sequence Homo sapiens putative lymphocyte GO/Gi NM_0157 switch gene (GQS2), mRNA 14 UI-H-DF1 -auf-e-22-0-UI.sl BM99204 NCICGAPDFl Home sapiens cDNA 9 clone IMAGE:5868669 3, mRNA sequence Home sapiens ABI gene family, member 3 NM_0164 (ABI3), mRNA 28 UI-H-COO-arg-e-03-0-UI si BQ02798 NCICGAPSub9 Home sapiens cDNA 4 clone IMAGE:3 106611 3, mRNA sequence Homo sapiens Sadi and UNC84 domain NM_1527 containing 1 (SUNCII), mRNA 82 oj26f04.yl Human lacrimal gland, CD72379 unamplified: oj Home sapiens cDNA clone 8 oj26f04 5, mRNA sequence Home sapiens fibroblast growth factor 1 NM_0331 (acidic) (FGF1), transcript variant 2, mRNA 36 UI-CF-EC1-aea-g-1 1-0-Ulsi UI-CF-EC1 BU68826 Home sapiens cDNA clone UI-CF-ECI- 3 aea-g-1 1-0-1.113, mRNA sequence Home sapiens ankyrin repeat domain 1 NM_0143 (cardiac muscle) (ANKRD1), mRNA 91 Home sapiens G protein-coupled receptor 12.67 Down 12.17 Down 12.09 Down 12.02 Down 11.97 Down 11.76 Down 11.66 Down 11.19 Down 11.07 Down 11.05 Down 10.71 Down 5.54E-05 7.45E-04 8.65 3.62E-04 7. 1OE-05 6.37 E-04 1 .59E-04 5.11 E-03 2.89 E-04 9.03 E-03 4.91 24/05/06,15735 speci gp, 4 0 6 -407- NM_0239 87 (GPR87), mRNA Homo sapiens programmed cell death 1 NM_0252 ligand 2 (PDCD1LG2), mRNA 39 Homo sapiens wingless-type MMTV NM_0033 integration site family, member 92 (WNT5A), mRNA Homo sapiens zinc finger protein 323 NM_0308 (ZNF323), mRNA 99 Homo sapiens cysteine-rich, angiogenic NM_0015 inducer, 61 (CYR61), mRNA 54 Human mRNA for KIAA0335 gene, partial AB00233 cds 3 Homo sapiens EPH receptor A3 (EPHA3), NM_0052 transcript variant 1, mRNA 33 Homo sapiens chromosome 16 open NM_0246 reading frame 30 (C16orf30), mRNA 00 Homo sapiens GATA binding protein 2 NM_0326 (GATA2), mRNA 38 U79271 Human clones 23920 and 23921 mRNA sequence Homo sapiens lactate dehydrogenase C NM_0174 (LDHC), transcript variant 2, mRNA 10.6 Down 1.03E-03 10.52 Down 10.28 Down 10.27 Down 10.22 Down 1.11E-02 1.90E-03 5.12E-03 4.90E-05 10.14 Down 2.91E-03 10.11 Down 3.10E-03 9.99 Down 2.21E-04 9.88 Down 5.41E-05 9.74 Down 2.07E-04 Homo sapiens calponin 1, basic, smooth 9.63 Down 3.67E-04 24/05/06,15735 speci gp,407 -408- NM_0012 99 muscle (CNN mRNA tf23h06.x5 NCICGAPBrn23 Homo A1939462 sapiens cDNA clone IMAGE:2097083 3, mRNA sequence Homo sapiens layilin (LOC 143903), mRNA NM_1 788 34 Homo sapiens breast cancer antigen NY- AF26908 BR-1.1 mRNA, partial cds 9.62 Down 8.51 9.59 Down 1.13E-05 9.42 Down 2.10E-03 NM_0019 NM_0047 91 Homo sapiens diphtheria toxin receptor (heparin-binding epidermal growth factorlike growth factor) (DTR), mRNA Homo sapiens integrin, beta-like 1 (with EGF-like repeat domains) (ITGBL mRNA Homo sapiens adrenergic, alpha-2B-, NM_0006 receptor (ADRA21B), mRNA 82 Homo sapiens dickkopf homolog 1 NM_0122 (Xenopus Iaevis) (DKK1), mRNA 42 Homo sapiens fibulin 2 (FBLN2), transcript NM-001 9 variant 2, mRNA 98 9.37 Down 2.21 E-02 9.24 Down 2.86E-04 9.19 Down 9.68E-04 9.18 Down 2.05E-03 9.07 Down 5.02E-04 BG1 6574 602344592F1 NIHMGC_89 Homo sapiens cDNA clone IMAGE:4454470 5, mRNA sequence 9.04 Down 1.30E-03 8.93 Down 2.86E-04 D29453 HUMNK566 Human epidermal keratinocyte Homo sapiens cDNA clone 566, mRNA sequence 24/05/06,15735 speci gp,408 409 ojl6hO2.yl Human lacrimal gland, CD72300 unamplified: oj Homo sapiens cDNA clone 6 Ojl6hO2 5, mRNA sequence Homo sapiens hypothetical protein NM_1785 MGC48998 (MGC48998), mRNA Homo sapiens angiomotin like 2 (AMOTL-2), NM_0162 mRNA 8.93 Down 9.36E-05 8.87 Down 3.76E-04 8.62 Down 2.48E-02 AW2917 Ul-H-B12-agv-h-04-0-Ul .sl NCICGAPSub4 Homo sapiens cDNA clone IMAGE:2725855 3, mRNA sequence 8.5 Down 3.03E-03 Homo sapiens chromosome 7 open reading NM_1 527 frame 6 (C7orf6), mRNA 03 Homo sapiens contactin 1 (CNTN1), NM_001 8 transcript variant 1, mRNA 43 Homo sapiens mRNA; cDNA ALl1745 DKFZp586J1717 (from clone 4 DKFZp586J1717) 8.38 Down 1.58E-04 8.32 Down 5.41 8.26 Down 5.79E-05 BX09200 4 BX092004 NCICGAPKidli1 Homo sapiens cDNA clone IMAGp998B 195924; IMAGE:2385330, mRNA sequence 8.18 Down 4.67E-04 8.16 Down 1.64E-03 Homo sapiens similar to CG3714 gene NM_1452 product (PP3856), mRNA BX53769 8 Homo sapiens mRNA; cDNA DKFZp686F09166 (from clone DKFZp686FO91 66) 8.15 Down 7.27E-04 Homo sapiens Down syndrome critical NM_2034 region gene 1 (DSCR1), transcript variant 8.12 Down 2.96E-02 24/05/06,15735 speci gp,409 -410- 18 3, mRNA Homo sapiens desmocollin 3 (DSC3), NM_0244 transcript variant Dsc3b, mRNA 23 Homo sapiens cDNA FLJ36210 fis, clone AK09352 THYMU20001 9 Homo sapiens cDNA FLJ16761 fis, clone AK1 3153 BRAMY3008096 2 Homo sapiens chromosome 6 open reading NM_0325 frame 168 (C6orfl68), mRNA 11 Homo sapiens natriuretic peptide precursor NM_0025 B (NPPB), mRNA 7.93 Down 2.54E-03 7.9 Down 9.50E-04 7.89 Down 1.84E-03 7.42 Down 3.49E-03 7.4 Down 4.45E-03 7.34 Down 7.03E-05 BU62632 6 UI-H-DFO-bet-p-1 7-0-Ulsi NCICGAPDF0 Homo sapiens cDNA clone UI-H-DFO-bet-p-17-0-UI 3, mRNA sequence Homo sapiens autocrine motility factor receptor (AMFR), transcript variant 1, mRNA NM_001 1 44 Homo sapiens heat shock 27kDa protein 2 NM_0015 (HSPB2), mRNA 7.33 Down 1.03E-03 7.32 Down 3.96E-03 7.31 Down 1.23E-03 NM_0050 69 Homo sapiens single-minded homolog 2 (Drosophila) (SIM2), transcript variant SIM2, mRNA wp76c02.xl NCICGAPBrn25 Homo A1937359 sapiens cDNA clone IMAGE:2467682 3, mRNA sequence 7.31 Down 1.96E-03 24/05/06,15735 speci gp, 4 -411- INO Homo sapiens dishevelled associated NM_0153 activator of morphogenesis 2 (DAAM2), mRNA Homo sapiens collagen, type 1, alpha 2 NM_0000 (COL1A2), mRNA 89 Homo sapiens raft-linking protein NM_0151 (RAFTLIN), mRNA BX1 13319 NCICGAPGas4 Homo BX1 1331 sapiens cDNA clone IMAGp998G205398; 9 IMAGE:2184619, mRNA sequence Homo sapiens solute carrier family 43, NM_1993 member 3 (SLC43A3), mRNA 29 AV702977 ADB Homo sapiens cDNA clone AV70297 ADBCVD08 5, mRNA sequence 7 Homo sapiens leucine rich repeat NM_0245 containing 2 (LRRC2), mRNA 12 Homo sapiens PDZ domain protein GIPC2 NM_0176 (GIPC2), mRNA Homo sapiens chromosome 20 open NM_0144 reading frame 10 (C20orflO), mRNA 77 Homo sapiens purinergic receptor P2X, NM_0025 ligand-gated ion channel, 3 (P2RX3), 59 mRNA UI-CF-EN1-acz-f-03-0-UI.sl UI-CF-EN1 BM97638 Homo sapiens cDNA clone UI-CF-EN1-acz- 7.29 Down 2.18E-05 7.25 Down 6.07E-03 7.24 Down 2.87E-03 7.24 Down 1.28E-03 7.19 Down 2.31 E-03 7.11 Down 5.21 7.09 Down 2.65E-04 7.06 Down 2.04E-04 7.05 Down 4. 1OE-03 7.03 Down 4.63E-03 7.01 Down 9.77E-04 24/05/06,15735 speci gp,41 I -412f-03-0-UI 3, mRNA sequence Homo sapiens mRNA; cDNA DKFZp686KIO163 (from clone DKFZp686K1 0163) BX64832 3 6.94 Down 8.05E-04 6.93 Down 5.41 INO Homo sapiens, clone IMAGE:4179986, BC00858 mRNA, partial cds 0 Homo sapiens DnaJ (Hsp4O) homolog, NM_-0070 subfamily B, member 4 (DNAJB4), mRNA 34 wu97glO.xl NCICGAPKid3 Homo AW0255 sapiens cDNA clone IMAGE:2528034 3, 56 mRNA sequence Homo sapiens histone 1, H2am NM_0035 (HIST1H2AM), mRNA 6.72 Down 2.98E-02 6.7 Down 2.31 E-03 6.7 Down 9.11 E-03 6.65 Down 2.58E-03 Homo sapiens lysyl oxidase-like 3 (LOXL-3), mRNA NM_0326 03 AW1726 52 NM_0063 BQ01 858 6 BF4481 5 8 xj8OfO6.xl SoaresNFLTGBCSi Homo sapiens cDNA clone IMAGE:2663555 3, mRNA sequence Homo sapiens follistatin (FST), transcript variant FST317, mRNA UI-H-DHI -awu-c-08-0-UI.sl NCICGAPDH1 Homo sapiens cDNA clone IMAGE:5823679 3, mRNA sequence 2.xl Lupski sympathetic-trunk Homo sapiens cDNA clone IMAGE:4090607 3, mRNA sequence Homo sapiens interleukin 8 receptor, beta 6.62 Down 2.17E-04 6.57 Down 7.59E-05 6.43 Down 3.44E-03 6.43 Down 8.65E-05 6.38 Down 2.96E-03 24/05/06,15735 speci gp,412 -413- NM_0015 (IL8RB), mRNA 57 Homo sapiens inhibitor of DNA binding 2, NM_0021 dominant negative helix-loop-helix protein 66 (0D2), mRNA Homo sapiens potassium voltage-gated NM_0806 channel, Isk-related family, member 4 71 (KCNE4), mRNA UI-E-EJO-ahi-c-1 6-0-U ri UI-E-EJO Homo BM7 1294 sapiens cDNA clone UI-E-EJO-ahi-c-16-0- UI 5, mRNA sequence UI1-H-DIF1-auk-h-02-0-UI.sl BM99189 NCICGAPDFl Homo sapiens cDNA 0 clone IMAGE:5870641 3, mRNA sequence Homo sapiens dual specificity phosphatase NM_0178 23 (DUSP23), mRNA 23 Homo sapiens SPANX family, member BI NM_0324 (SPANXB1), mRNA 61 Homo sapiens exonuclease 1 (EX0l), NM_0060 transcript variant 1, mRNA 27 Homo sapiens histone 1, HWe (HISTi HWE), NM_0035 mRNA Homo sapiens forkhead box Fl (FOXFl), NM_0014 mRNA 51 Homo sapiens endothelin 1 (EDNII), mRNA NM_0019 6.37 Down 2.10E-03 6.36 Down 1.17E-02 6.33 Down 3.62E-04 6.32 Down 8.14E-05 6.26 Down 9.36E-03 6.26 Down 5.62E-03 6.26 Down 7.81 E-03 6.19 Down 7.48E-03 6.17 Down 1.02E-03 6.16 Down 2.54E-03 24/05/06,15735 speci gp.413 -414- INO Homo sapiens regulator of G-protein SNM_0036 signalling 5 (RGS5), mRNA 17 Homo sapiens thymosin, beta 10 V) NM_0211 (TMSB10), mRNA 03 Homo sapiens epithelial membrane protein NM_0014 2 (EMP2), mRNA CN 24 s CDCA6 Cell division cycle associated gene BG35457 6 Human cDNA expression libraries Homo c 9 sapiens cDNA clone 407614, mRNA sequence UI-E-CQ1-aex-n-03-0-UI.s1 UI-E-CQ1 BM66545 Homo sapiens cDNA clone UI-E-CQ1-aex- 2 n-03-0-UI 3, mRNA sequence Homo sapiens myosin, light polypeptide 6, NM_0794 alkali, smooth muscle and non-muscle 23 (MYL6), transcript variant 2, mRNA UI-H-BI1-abv-a-11-0-UI.sl AW1344 NCI_CGAP_Sub3 Homo sapiens cDNA 73 clone IMAGE:2712885 3, mRNA sequence Homo sapiens hypothetical protein NM_0323 MGC14595 (MGC14595), mRNA 34 601765592F1 NIH_MGC_53 Homo sapiens BF02935 cDNA clone IMAGE:3997510 5, mRNA 6 sequence Homo sapiens hypothetical protein NM_1758 LOC222171 (LOC222171), mRNA 87 Homo sapiens FYVE, RhoGEF and PH 6.07 Down 9.24E-03 6.06 Down 2.32E-02 6.06 Down 2.23E-03 5.96 Down 1.40E-03 5.94 Down 2.64E-04 5.87 Down 3.58E-02 5.85 Down 1.03E-03 5.79 Down 9.11E-03 5.78 Down 3.55E-03 5.72 Down 3.51E-04 5.72 Down 3.12E-03 24/05/06,15735 speci gp. 4 14 -415- INO NM_1392 domain containing 4 (FGD4), mRNA 41 Homo sapiens spastic paraplegia 3A NM_0159 (autosomal dominant) (SPG3A), mRNA Homo sapiens similar to hypothetical NM_0529 protein FLJ10883 (LOC115294), mRNA 37 Homo sapiens KIAA0431 protein NM_0152 (KIAA0431), mRNA 51 Homo sapiens glutamate receptor, NM_0219 ionotropic, kainate 2 (GRIK2), transcript 56 variant 1, mRNA Homo sapiens lymphocyte antigen 6 NM_0175 complex, locus K (LY6K), mRNA 27 Homo sapiens phospholipase C, beta 1 NM_0151 (phosphoinositide-specific) (PLCB1), 92 transcript variant 1, mRNA Homo sapiens family with sequence NM_0202 similarity 20, member C (FAM20C), mRNA 23 Homo sapiens platelet factor 4 (chemokine NM_0026 (C-X-C motif) ligand 4) (PF4), mRNA 19 Homo sapiens guanylate binding protein 1, NM_0020 interferon-inducible, 67kDa (GBP1), mRNA 53 H55853 yq94c05.rl Soares fetal liver spleen 1NFLS Homo sapiens cDNA clone IMAGE:203432 mRNA sequence 5.69 Down 7.86E-03 5.6 Down 3.87E-04 5.7 Down 2.15E-03 5.58 Down 2.31E-03 5.57 Down 1.69E-02 5.53 Down 7.81E-03 5.51 Down 1.19E-03 5.51 Down 3.31E-04 5.51 Down 1.27E-03 5.5 Down 6.78E-03 24/05/06,15735 speci gp,415 -416- Homo sapiens primase, polypeptide 2A, NM_0009 58kDa (PRIM2A), mRNA 47 Homo sapiens nuclear factor I/B (N FIB), NM_0055 mRNA 96 Homo sapiens exosome component 2 NM_0142 (EXOSC2), mRNA Homo sapiens tetratricopeptide repeat NM_0046 domain 4 (TTC4), mRNA 23 Homo sapiens elastin microfibril interfacer 3 NM_0528 (EMILIN3), mRNA 46 xg63e03.xl NCICGAPUt4 Homo sapiens AW1523 cDNA clone IMAGE:2633020 3 similar to 68 contains Alu repetitive element;, mRNA sequence Homo sapiens nuclear receptor subfamily NM_0004 0, group B, member 1 (NROB1), mRNA Homo sapiens prefoldin 2 (PFDN2), mRNA NM_0123 94 Homo sapiens hypothetical protein NM_0190 FLJ1 1127 (FLA11127), mRNA 18 Homo sapiens nucleoporin l55kDa NM_0042 (NUPiS55), transcript variant 2, mRNA 98 Homo sapiens histone 2, H2aa 5.48 Down 8.13E-03 5.46 Down 1.OOE-04 5.45 Down 1.45E-02 5.43 Down 1.84E-02 5.43 Down 1. 11 E-04 5.41 Down 5.48E-04 5.39 Down 1.85E-03 5.38 Down 3.93E-02 5.32 Down 1.05E-02 5.3 Down 5.08E-02 5.3 Down 3.90E-02 24105/06,15735 speci gp.416 -417- NM_0035 (H!ST2H2AA), mRNA 16 Homo sapiens BCL-2-associated X protein NM_0043 (BAX), transcript variant beta, mRNA 24 Homo sapiens CipP caseinoiytic protease, NM_0060 ATP-dependent, proteolytic subunit 12 homolog coli) (CLPP), nuclear gene encoding mitochondrial protein, mRNA Homo sapiens histone 1, H4j (HIST1H4J), NM_0219 mRNA 68 BF1I71 0 7147c Oxi SoaresNSFF8_9WOTPAPSi Homo sapiens cDNA clone IMAGE:3524371 3, mRNA sequence 5.27 Down 2.42E-02 5.22 Down 3.42E-03 5.19 Down 1.84E-02 5.19 Down 1.23E-03 5.16 Down 3.83E-02 5.15 Down 6.63E-03 5.14 Down 1.79E-02 5.14 Down 9.07E-03 5.13 Down 1.18E-02 Homo sapiens COP9 constitutive NM_0068 photomorphogenic homolog subunit 37 (Arabidopsis) (COPS5), mRNA Homo sapiens hyaluronan and NM_0018 proteoglycan link protein 1 (HAPLN1), 84 mRNA Homo sapiens peroxisomal membrane NM_01 86 protein 2, 22kDa (PXMP2), mRNA 63 BX09332 9 BX093329 Soares-parathyroid-tumorNbHPA Homo sapiens cDNA clone IMAGp998A124183; IMAGE:1648403, mRNA sequence Homo sapiens ubiquitin specific protease NM_001 0 16 (USP1 transcript variant 2, mRNA 01992 24/05/06,15735 speci gp, 4 I 7 -418- INO Ct Homo sapiens tyrosine 3- NM_0034 monooxygenase/tryptophan monooxygenase activation protein, eta polypeptide (YWHAH), mRNA Homo sapiens transforming growth factor, NM_0032 beta 2 (TGFB2), mRNA 38 T95596 ye4ObO3.sl Soares fetal liver spleen 1 NFLS Homo sapiens cDNA clone IMAGE: 120173 3, mRNA sequence Homo sapiens dehydrogenase/reductase NM_0047 (SDR family) member 3 (DHRS3), mRNA 53 Homo sapiens gap junction protein, alpha NM_0001 1, 43kDa (connexin 43) (GJA1), mRNA H99504 yx25g05.sl Soares melanocyte 2NbHM Homo sapiens cDNA clone IMAGE:262808 3, mRNA sequence Homo sapiens tolloid-like 1 (TILL1), mRNA NM_0124 64 Homo sapiens heart alpha-kinase (HAK), NM_0529 mRNA 47 5.11 Down 1.09E-02 5.09 Down 2.36E-03 5.08 Down 3.51 E-04 5.07 Down 6.56E-03 5.04 Down 2.07E-03 5.04 Down 1.13E-03 5.03 Down 3.47E-02 5.02 Down 1.06E-04 24/05/06.15735 speci gp,418 -419- TABLE VIII: REAL TIME PCR DATA FOR DIFFERENTIATED AF-1 CELLS Hormone Ct values for AFCA007 Clone A cultured for 2 wks in Amniomax Ct values for AFCA007 Clone A cultured for 2 wks in Amniomax micro molar retinoic acid AACt for AFCA007 Clone A cultured for 2 wks in Amniomax AACt for AFCA007 Clone A cultured for 2 wks in Amniomax 10 micro molar retinoic acid GIP 34 31 0.00062 0.004 Neurotensin 37 35 0.000183 0.0004 Gastrin No 36 0.0004 expression Secretin 32 32 0.02 0.014 Somatostatin 31 28 0.002 0.014 CCK 33 31 0.003 0.008 GAPDH 22 22 For AAC, analysis, the positive control was human intestinal RNA 24/05/06,15735 speci gp,419 420 TABLE IX: PCR ANALYSIS OF THE EXPRESSION OF ENDODERM MARKERS IN AFCA007 (P8) AFTER 14-DAYS OF DIFFERENTIATION ASSAY Treatment HNF73I Pdx-1I GATA4 Glu-2 H4NFlct AFP Untreated FGF4 50ng/mI All-trans RA tiM) L-685,458 jiM) Cyclopamine PiM) ng/mI) BMP6 ng/mI) Excendlin 4 rim) BMP7 ng/mi) BMP4 24/05/06,15735 speci gp,420 2006202209 25 May 2006 422 TABLE X: CYTOKINE, CYTOKINE AND GROWTH FACTOR RECEPTOR EXPRESSION LEVEL FOR AFCA007 A (AF-I) AND AFCA015 C (AF-Il) CELLS AFCA007 A AFCA007 A AFCA015 C AFCA015 C Pos NEG Angiogen in BDNF BLC BMP-4 BMP-6 CK beta 8-1 CNTF EGF Eotaxin Eotaxin-2 Eotaxin-3 FGF-6 FGF-7 Fit-3 Ligand Fractalkine GCP-2 GDNF GM-CSF 23,029.50 1.00 44.50 702.50 276.50 66.00 135.00 139.50 235.50 125.50 90.00 635.00 174.50 422.00 378.50 298.00 545.50 323.00 249.00 1,003.50 22,843.43 0.98 89.98 670.09 365.08 96.36 182.17 100.28 234.64 106.66 95.87 554.86 245.43 411.67 348.41 264.56 399.41 266.52 213.56 687.75 23,281.28 23,086.51 0.86 0.86 101.17 26.71 590.28 411.52 192.90 0.86 126.89 117.22 247.34 133.53 80.16 43.87 82.73 0.86 66.01 0.86 152.61 99.21 528.55 290.54 246.48 170.42 318.07 213.32 225.05 15.12 146.18 66.60 330.50 105.21 182.18 0.86 100.74 15.55 663.15 343.31 24/05/06,15735 speci gp, 4 22 -423- 1-309 108.00 90.47 91.74 36.57 IFN-gamma 227.50 189.04 217.34 7.40 IGFBP-1 156.00 197.37 182.61 37.00 IGFBP-2 627.00 415.10 383.66 281.53 IGFBP-4 154.00 136.57 103.74 0.86 IGF-l 121.00 200.32 218.62 191.01 474.50 379.30 320.22 64.89 IL-13 768.00 627.43 636.57 184.58 829.50 542.60 558.56 226.62 IL-1 6 243.50 235.62 146.18 2.25 IL-lalpha 1,206.00 1,058.47 1,048.95 662.05 I L-1 beta 349.00 282.21 258.49 64.89 IL-Ira 278.50 337.13 225.05 111.65 IL-2 684.50 581.34 489.97 254.50 IL-3 1,052.50 1,066.31 1,075.53 904.86 IL-4 396.00 404.80 383.23 224.47 763.00 676.96 754.89 303.41 IL-6 1,172.00 1,113.88 485.25 327.43 IL-7 675.00 567.61 473.68 241.63 Leptin 269.50 267.99 229.77 118.08 LIGHT 295.50 254.75 214.33 85.48 MCP-I 1,027.00 901.06 1,080.25 990.24 MCP-2 546.00 461.20 389.66 120.66 MCP-3 378.50 372.93 288.49 85.91 24/05/06,15735 speci gp.423 424 MCP-4 642.50 532.30 390.95 159.69 M-CSF 692.00 566.63 504.11 267.37 MDC 446.50 442.07 312.07 138.24 MIG 760.00 725.51 701.30 363.47 MIP-1-delta 290.50 347.92 295.78 117.65 MIP-3-alpha 406.50 399.90 311.64 64.46 NAP-2 216.50 241.51 208.33 44.29 NT-3 45.50 124.31 61.30 0.86 PARC 181.50 208.16 138.46 0.86 PDGF-BB 594.00 313.10 126.03 152.83 RANTES 418.50 350.86 248.63 108.21 SCF 307.50 152.26 84.45 45.58 SDF-1 654.50 594.09 237.48 116.37 TARC 227.50 264.56 148.75 2.25 TGF-beta 1 824.50 750.02 693.59 407.23 TGF-beta 3 278.00 341.54 277.35 57.16 TNF-alpha 804.50 968.73 992.37 552.23 TNF-beta 549.50 510.23 888.20 285.82 24,267.79 23,873.40 25,002.74 25,119.43 NEG 1.00 0.89 0.78 0.78 Acrp3O 29.13 0.89 100.74 98.12 AgRP 1.00 0.89 19.30 0.78 Angiopoietin-2 144.13 84.27 62.74 58.01 Amphiregulin 1.00 0.89 0.78 0.78 24/05/06.15735 speci gp, 424 425 Axi 1,478.63 882.74 542.12 536.93 bFGF 5,455.13 4,386.44 4,419.49 7,225.00 b-NGF 94.13 8.27 69.72 58.79 BTC 1.00 0.89 0.78 0.78 CCL-28 141.13 76.23 0.78 0.78 CTACK 383.13 315.86 304.37 297.86 Dtk 90.13 51.19 48.77 48.67 EGF-R 1,730.13 851.89 1,363.21 1,485.42 ENA-78 207.13 109.31 514.97 192.34 Fas/TNFRSF6 4,740.63 1,570.79 1,026.94 575.87 FGF-4 342.13 141.50 156.21 88.77 FGF-9 267.13 166.98 140.69 100.07 GCSF 320.63 151.78 152.33 115.25 GITR-Ligand 183.63 112.44 170.17 81.77 GITR 211.13 116.91 63.51 18.30 GRO 10,097.13 9,584.54 2,380.16 1,317.60 GRO-alpha 1,061.13 754.43 356.73 124.60 HCC-4 90.63 18.55 67.00 8.18 HGF 1.00 0.89 265.19 333.29 ICAM-1 11,257.63 6,308.40 2,116.03 1,415.33 ICAM-3 75.13 19.89 54.98 61.52 IGFBP-3 603.63 406.61 435.46 346.92 IGFBP-6 523.63 334.63 253.56 176.77 IGF-I SR 929.13 526.87 484.72 463.73 24/05/06,15735 speci gp.42S 426 IL-I R4IST2 330.63 297.97 272.95 171.71 IL-I RI 57.13 40.91 40.24 16.74 IL-lI1 192.13 106.63 79.80 19.86 1IL-12 P40 134.13 113.33 99.19 93.06 IL-12 p70 183.63 165.64 166.29 85.27 IL-17 47.13 0.89 0.78 0.78 IL-2 Rapha 229.13 158.04 115.87 36.21 IL-6 R 158.63 30.62 55.75 46.72 IL-8 2,792.13 2,894.57 528.93 164.70 1-TAC 499.63 184.42 139.53 89.16 Lymphotactiri 581.63 277.86 295.45 215.71 MIF 2,280.63 1,794.32 1,532.31 1,042.71 MIP-lalpha 557.13 448.19 319.49 261.65 MIP-Ibeta 193.13 133.45 182.58 225.44 MIP-3beta 360.13 203.19 126.34 101.23 MSP-alpha 251.13 174.13 121.69 89.94 NT-4 115.13 27.94 2.62 0.78 Osteoprotegerin 2,391.13 1,761.24 1,558.30 1,582.37 Oncostatin M 541.13 340.45 179.48 98.51 PIGF 88.13 50.74 40.24 11.29 604.13 503.63 369.92 379.24 sTNF Ril 17.63 0.89 0.78 8.57 sTNF-RI 903.63 551.91 685.63 469.18 TECK 255.63 91.87 140.69 100.46 24/05/06,15735 spci gp,426 -427- TIMP-1 1,099.63 732.53 661.58 832.85 TIMP-2 11,468.63 7,205.68 14,022.74 14,546.57 Thrombopoietin 580.13 364.59 405.21 281.90 TRAIL R3 1,881.13 728.50 988.93 1,186.39 TRAIL R4 437.13 412.42 172.89 233.23 uPAR 1,055.13 631.49 668.56 960.95 VEGF 418.13 293.95 290.79 452.44 VEGF-D 39.13 0.89 20.85 12.46 POS 17,605.50 17,898.76 18,624.45 19,358.48 NEG 1.00 1.04 1.02 1.09 Activin A 7.00 106.51 131.02 216.38 ALCAM 227.00 372.00 229.19 194.01 B7-1(CD8O) 18.00 138.72 100.34 3.55 42.50 129.37 90.63 42.29 BMP-7 72.00 136.12 111.59 1.09 Cardiotrophin-1 578.00 1,221.99 498.65 233.30 CD14 118.00 231.72 134.09 180.37 CXCL- 16 1.00 187.56 201.07 175.45 DR6 (TNFRSF2I) 107.00 382.39 190.84 1.09 Endloglin 1,213.50 735.17 1,168.45 1,359.16 ErbB3 183.50 269.13 226.63 167.81 E-Selectin 150.00 250.94 178.06 82.68 Fas Ligand 134.00 269.65 162.72 88.14 ICAM-2 364.50 416.16 273.16 203.83 24/05/06,15735 speci gp, 4 27 -428- IGF-11 172.00 206.26 140.22 89.77 IL-I R 11 178.00 226.52 190.33 124.70 124.50 111.18 91.14 194.56 IL-13 Ralpha2 94.50 117.94 80.40 1.09 IL-18 BPalpha 3.00 132.49 234.82 1.09 IL-18 Rbeta 59.50 191.71 112.61 1.09 IL-2 Ralpha 128.00 156.90 149.94 50.48 IL-2 Rbeta 1.00 57.15 196.98 1.09 IL-2 Rgamma 1.00 1.04 1.02 1.09 I L-21 R 153.50 166.78 146.36 70.67 Ralpha 133.00 166.78 150.96 21.01 IL-9 169.00 184.96 155.56 57.58 91.50 211.46 161.19 94.14 LAP 3,066.00 2,460.08 5,775.28 6,813.80 Leptin R 225.50 223.41 168.35 230.03 LIF 93.50 181.84 495.07 217.48 L-Selectin 87.50 103.91 122.84 1.09 M-CSF R 1.00 193.27 65.57 167.27 MMP-I 206.50 170.93 135.11 379.56 MMP-13 158.50 149.11 119.26 57.58 MMP-9 1.00 137.16 56.37 167.81 MPIF-I 1.00 291.47 1.02 1.09 NGF R 1.00 123.13 388.21 1.09 PDGF AA 331.50 311.21 470.01 493.62 24105/06,15735 speci gp.428 429 PDG F-A B PDGF Raipha PDGF Rbeta PECAM-I Prolactin SCF R SD F-I beta TGF-alpha TGF beta2 Tie-I Tie-2 TIMP-4 VE-Cadherin VEGF R2 VEGF R3 TABLE XI: 48.50 111.70 1.00 184.96 1,199.50 859.86 41.50 138.72 285.00 272.77 64.50 245.75 425.50 364.73 152.50 153.79 69.50 227.04 173.50 138.72 8.50 124.69 153.00 90.92 49.50 97.68 77.00 139.24 59.50 164.70 37.50 121.06 PROTEINS CAPABLE OF DETECTION ARRAYS 137.67 174.48 3,513.79 280.32 195.44 128.46 248.11 1.02 140.74 182.15 373.89 231.24 93.70 131.02 101.37 222.54 BY ANTIBODY 248.58 1.09 4,030.00 190.74 59.76 88.68 452.14 1.09 166.72 118.70 101.78 18.28 17.74 85.41 78.86 54.85 Cytokine Full Name Activin A EDF(erythroid differentiation factor), FRP(Follicle stimulating hormone releasing protein), Restrictin-P, WEHI-MIF(WEHI mesoderm inducing factor) AGRP Agouti related protein ALCAM Activated leukocyte cell adhesion molecule Amphiregullin Amphiregulin ANG Angiogenin Angiopoietin-1 Angiopoietin-1 Angiopoietin-like Factor Angiopoietin-like Factor Angiostatin Angiostatin APRIL A proliferation-inducing ligand 24/05/06,15735 speci gp,429 -430- AXL A protein tyrosine kinase also called UFO or ark The ligand for this receptor is GPF (growth-potentiating factor The ligand is called also axl stimulatory factor,which is with one of the gas genes gas-6. B7-1 (CD8O) 137-1 (0080) BAFF B-cell-activating factor belonging to the TNF family BDNF Brain-derived neurotrophic factor Betacellulin Betacellulin beta -Galactos idase beta-Galactosidase beta-NGF Nerve growth factor-beta bFGF Basic fibroblast growth factor BLC B-lymphocyte chemoattractant BMP-2 Bone morphogenetic proteins -2 BMP-4 Bone morphogenetic proteins -4 Bone morphogenetic proteins BMP-6 Bone morphogenetic proteins -6 BMP-7 Bone morphogenetic proteins -7 BTC BetacelluIi n CCL28 00K-I CD27 Cluster of Differentiation 27 Cluster of Differentiation Cluster of Differentiation Ligand Cluster of Differentiation 40 ligand Ck beta 8-1 Chemokine-beta-8 CNTF Ciliary neuronotrophic factor, ciliary factor Cripto-1 CRGF (Cripto growth factor) CTACK CTAC (Cuteaneous T-Cell Attracting Chemokine); Skinkine; Eskine CTLA-4 Cytotoxic T-lymphocyte associated antigen 4 CXCL16 CXC Chemokine ligand 16 Dkk-4 Dickkopf-4 DR6 Death Receptor 6 Dtk Developmental tyrosine kinase EGF Epidermal growth factor EGR-R Epidermal growth factor related protein ENA-78 Epithelial neutrophil-activating protein 78, epithelial cellderived attractant-78 Endostatin Endostatin Eotaxin Eotaxin Eotaxin-2 MPIF-2 (Myeloid progenitor inhibitory factor-2 ),Chemokine-beta-6 Eotaxin-3 IMIP-4-alpha (macrophage inflammatory 24/05/06.15735 speci gp,430 431 protein-4-alpha TSC-1 (thymic stroma chemokine-1) Erythropoietin Erythropoietin E-Selectin E-Selectin Fas Ligand FasL-, CD95 ligand, Apo-1 ligand Fas/TNFRSF6 Fas or FGF-2 Fibroblast growth factor-2 FGF-4 Fibroblast growth factor-4 FGF-6 Fibroblast growth factor-6 FG F-7 Fibroblast growth factor-7 FGF-8 Fibroblast growth factor-8 FGF-9 Fibroblast growth factor-9 FKN or FK Fractalkine Flt-3 Ligand fins-like tyrosine kinase-3 Ligand (also known as STK- 1 Ligand) Follistatin Follicle stimulating hormone suppressing (FSP) GCP-2 Granulocyte Chemnotactic Protein 2 GCSF Granulocyte-colony Stimulating Factor growth/differentiation factor-i GDNF Glial-derived Neurotrophic Factor GITR Glucocorticoid induced tumor necrosis factor GITR-Ligand Glucocorticoid induced tumor necrosis factor GMV-CSF Gran ulocyte-macrophage colony stimulating GRO Growth Related Oncogene GRO-a Growth Related Oncogene-Alpha HB-EGF Heparin-binding Epidermal Growth factor HCC-4 Heinofiltrate CC Chemokine 4 HGF Hepatocyte growth factor HPTA Hepatopoeitin A HRG Heregulin/NDF/GGF/Neuregulin HRG-alpha Heregulin/NDF/GGF/Neuregulin HRG-beta Heregulin/NDF/GGF/Neuregulin HVEM Herpesvirus entry mediator 1-309 1-309 ICAM-1 Intercellular Adhesion Molecule 1 ICAM-2 Intercellular Adhesion Molecule 2 ICAM-3 Intercellular Adhesion Molecule 3 IFN-alpha Interferon alpha IFN-beta Interferon beta 24/05/06,15735 speci gp,431 -432- IFN-gamma Interferon gamma IFN-omega Interferon omega IGFBP-1 Insulin-like growth factor binding proteins 1 IGFBP-2 Insulin-like growth factor binding proteins 2 IGFBP-3 Insulin-like growth factor binding proteins 3 IGFBP-4 Insulin-like growth factor binding proteins 4 IGFBP-6 Insulin-like growth factor binding proteins 6 IGF-I SR Insulin like growth factor I soluble receptor IGF-I Insulin-like growth factor-i IGF-II Insulin-like growth factor II IL-I R1 Interleukin 1 receptor-related protein-i IL-1 R4/ST2 Interleukin 1 receptor 4, also known as ST2 Interleukin R alpha Interleukin 10 soluble receptor alpha R beta Interleukin 10 receptor beta IL-11 Interleukin 11 IL-12 Interleukin 12 IL-12 p40 Interleukin 12p40 IL12p70 Interleukin 12p70 IL-13 Interleukin 13 Interleukin IL-16 Interleukin 16 IL-17 Interleukin 17 IL-18 BPa Interleukin 18 binding protein A IL-18 R alpha Interleukin 18 receptor alpha IL-18 R beta Interleukin 18 receptor beta IL-18 Interleukin 18 IL-la Interleukin I alpha IL-lb Interleukin I beta IL-1ra Interleukin 1 receptor antagonist IL-2 Interleukin 2 IL-2 R alpha Interleukin 2 soluble receptor alpha IL-2 R beta Interleukin 2 soluble receptor beta IL-2 R gamma Interleukin 2 receptor gamma IL-21 R Interleukin 21 receptor IL-3 Interleukin 3 IL-4 Interleukin 4 Interleukin R alpha Interleukin 5 receptor alpha IL-6 Interleukin 6 IL-7 Interleukin 7 IL-8 Interleukin 8 24/05/06,15735 speci gp,432 -433- IL-9 Interleukin 9 IL-9 R Interleukin 9 receptor Inhibin A Inhibin A Inhibin B Inhibin B IFN inducible Protein 10, Immune Protein I-TAC Interferon-inducible T cell Alpha Chemoattractant LAP Liver activator protein TGF-LAP Tumor growth factor latency associated peptide LT-BP-1 Latent TGF-beta binding protein 1 LECT2 Leukocyte cell-derived chemotaxin-2 LEPTIN R LEPTIN receptor LFA-1 alpha Lymphocyte function-associated antigen 1 alpha LIF Leukemia Inhibitoty Factor LIGHT LIGHT LIX LPS induced C-X-C chemokine L-Selectin L-Selectin Lymphotactin Lymphotactin MAC-1 Macrophage galactose-specific lectin-1 MMP-13 Matrix Metalloproteinase 13 MMP-19 Matrix Metalloproteinase 19 MCP-1 Monocyte Chemoattractant Protein 1 MCP-2 Monocyte Chemoattractant Protein 2 MCP-3 Monocyte Chemoattractant Protein 3 MCP-4 Monocyte Chemoattractant Protein 4 MCSF Macrophage-colony Stimuating Factor M-CSF R Macrophage colony stimulating factor receptor MDC Macrophage-derived Chemokine MIF Macrophage Migration Inhibitory Factor MIG Monokine induced by gamma interferon MIP-la Macrophage Inflammatory Protein 1 alpha MIP-1b Macrophage Inflammatory Protein 1 beta MIP-1d Macrophage Inflammatory Protein 1idelta MIP-2 Macrophage Inflammatory Protein 2 MIP-3 alpha Macrophage Inflammatory Protein 3 alpha MIP-3 beta Macrophage Inflammatory Protein 3 beta MMP-1 Matrix Metalloproteinase 1 Matrix Metalloproteinase MMP-11 (Stromelysin-3) Matrix Metalloproteinase 11 24/05/06.,15735 speci gp,433 -434- MMP-12 Matrix Metalloproteinase 12 MMP-13 Matrix Metalloproteinase 13 MMP-14 Matrix Metalloproteinase 14 MMP-2 Matrix Metalloproteinase 2 Matrix Metalloproteinase MMP-3 Matrix metalloproteinase 3 MMP-7 Matrix Metalloproteinase 7 MMP-8 Matrix Metalloproteinase 8 MMP-9 Matrix Metalloproteinase 9 MPIF-1 Myeloid Progenitor Inhibitory Factor 1 MSP a-chain Macrophage stimulating protein a-chain MSP b-chain Macrophage stimulating protein b-chain NAP-2 Neutrophil Activating Peptide 2 NGF Nerve growth factor NGF R Nerve growth factor receptor NT-3 Neurotrophin-4 NT-4 Neurotrophin-3 OPG Osteoprotegerin OSM Oncostatin M PARC Pulmonary and Activation-Regulated Chemokine PDGF R alpha Platelet-derived growth factor receptor alpha PDGF R beta Platelet-derived growth factor receptor beta PDGF-AA Platelet-derived Growth Factor AA PDGF-BB Platelet-derived Growth Factor BB PECAM-1 Platelet endothelial cell adhesion molecule PF4 Platelet factor 4 PIGF Placenta growth Factor Prolactin Prolactin P-selectin P-selectin RANTES Regulated upon activation, normal T-cell expressed, and presumably secreted SCF Stem Call Factor SCF R Stem cell factor receptor SDF-1 Stromal cell-derived factor SLPI Secretory leukocyte protease inhibitor SMDF Sensory and Motor Neuron-derived Factor SPARC Osteonectin ST2 Interleukin 1 receptor 4 TARC Thymus and Activation-Regulated Chemokine 24/05/06,15735 speci gp,4 3 4 -435- TECK Thymus-expressed Chemokine TGFa Tumor Necrosis Factor Alpha TGF-a Transforming growth factor alpha TGF-beta 1 Tumor Necrosis Facyor betal TGF-beta 2 Tumor Necrosis Facyor beta2 TGF-beta 3 Tumor Necrosis Facyor beta3 Thrombospondin (TSP) Thrombospondin Thymopoietin Thymoppietin (Tpo) Tie-1 Tyrosine kinase with Ig and EGF homology domains 1 Tie-2 Tyrosine kinase with immunoglobulin and epidermal growth factor homology domain 2 TIMP-1 Tissue inhibitor of metalloproteinases-1 TIMP-2 Tissue inhibitor of metalloproteinases-2 TIMP-3 Tissue inhibitor of metalloproteinase-3 TIMP-3 Tissue inhibitor of metalloproteinases-3 TIMP-4 Tissue inhibitor of metalloproteinase-4 TNF-a Tumor necrosis factor-alpha TNF-b Tumor necrosis factor-beta TPO Thrombopoietin TRAIL R1 TNF-related apoptosis-inducing ligand receptor 1 TRAIL R2 TNF-related apoptosis-inducing ligand receptor 2 TRAIL TNF-related apoptosis inducing ligand TRANCE Tumor necrosis factor-related activationinduced cytokine TSLP Thymic stromal derived lymphopoietin uPA Urokinase plasminogen activator Ab uPAR Urokinase plasminogen activator receptor VCAM-1 Vascular cell adhesion molecule (VCAM-1, CD106, or INCAM-110) VE-Cadherin Vascular epithelial cadherin VEGF Vascular Endothelial Growth Factor VEGF R2 Vascular endothelial growth factor receptor 2 VEGF R3 Vascular endothelial growth factor receptor 3 VEGF-B Vascular Endothelial Growth Factor B VEGF-C Vascular Endothelial Growth Factor C VEGF-D Vascular Endothelial Growth Factor D 24/05/06.15735 speci gp, 4 -436- Publications cited throughout this document are hereby incorporated by reference in N their entirety. Although the various aspects of the invention have been illustrated above by reference to examples and preferred embodiments, it will be appreciated that the scope of the invention is defined not by the foregoing description, but by the following claims properly construed under principles of patent law. Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and 1"comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps. The reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form or suggestion that the prior art forms part of the common general knowledge in Australia. 24/05/06,15735 speci gp,436
权利要求:
Claims (55) [1] 1. A substantially pure population of amniotic fluid-derived cells. [2] 2. The population of amniotic fluid-derived cells according to claim 1, wherein the cells of said population are substantially negative in the expression of at least one protein marker selected from the group consisting of: CD117, Oct-4, and Tra2-54. [3] 3. The population of amniotic fluid-derived cells according to claim 2, wherein the cells of said population are substantially positive for the expression of at least one protein marker selected from the group consisting of: HNF-1 beta, GATA-6, and Sox-17. [4] 4. The population of amniotic fluid-derived cells according to claim 2, wherein the cells of said population also express at least one gene selected from the group consisting of: HNF-3 beta, Hes-1, GATA-4 and Musashi-1. The population of amniotic fluid-derived cells according to claim 2, wherein the cells of said population are positive for the expression of at least one protein marker selected from the group consisting of: Liver Activator Protein, PDGF receptor P, AXL, bFGF, EGF receptor, Fas /TNFRSF6, GRO, GRO- alpha, ICAM-1, IL-lalpha, 11-3, 11-6, 11-8, MIF, Osteoprotegerin, TIMP-2, and TRAIL R3. [5] 6. The population of amniotic fluid-derived cells according to claim 2, wherein the cells of said population are substantially negative in the expression of the protein marker Sox-17. [6] 7. The population of amniotic fluid-derived cells according to claim 6, wherein the cells of said population are substantially negative in the expression of cytokeratin protein. [7] 8. The population of amniotic fluid-derived cells according to claim 6, wherein the cells of said population are positive for the expression of at least one protein marker selected from the group consisting of: Liver Activator Protein, 24/05/06,15735 speci gp. 4 3 7 -438- PDGF receptor P, bFGF, EGF receptor, GRO, GRO-alpha, ICAM-1, 11-3, 11-6, MIF, Osteoprotegerin, TIMP-2, and TRAIL R3. [8] 9. The population of amniotic fluid-derived cells according to claim 1, wherein the cells of said population are substantially negative in the expression of the protein marker Sox-17, and also express at least one gene selected from the group consisting of: Hes-1 and Musashi-l. The population of amniotic fluid-derived cells according to claim 1, wherein the cells of said population are substantially negative in the expression of CD117, Oct-4, Sox-17, and Tra2-54. [9] 11. The population of amniotic fluid-derived cells according to claim 10, wherein the cells of said population are substantially negative in the expression of cytokeratin protein. [10] 12. The population of amniotic fluid-derived cells according to claim 10, wherein the cells of said population are positive for the expression of at least one protein marker selected from the group consisting of: Liver Activator Protein, PDGF receptor P, bFGF, EGF receptor, GRO, GRO-alpha, ICAM-1, 11-3, 11-6, MIF, Osteoprotegerin, TIMP-2, and TRAIL R3. [11] 13. The population of amniotic fluid-derived cells according to claim 10, wherein the cells of said population are substantially negative in the expression of the protein marker Sox-17, and also express at least one gene selected from the group consisting of: Hes-1 and Musashi-1. [12] 14. The population of pancreatic amniotic fluid-derived cells according to claim 1, capable of propagating in vitro. The population of amniotic fluid-derived cells according to claim 1, capable of propagating in vitro under hypoxic conditions. [13] 16. The population of amniotic fluid-derived cells according to claim 1, capable of differentiating into cells displaying the characteristics of the p-cell lineage. 24/05/06,15735 speci gp.438 -439- [14] 17. The population of amniotic fluid-derived cells according to claim 1, capable of differentiating into a gut hormone-producing cell. [15] 18. A method of obtaining a population of cells from amniotic fluid, comprising: a. Isolating amniotic fluid, b. Isolating the cells from the amniotic fluid, c. Placing the cells in culture medium, d. Plating the cells in a culture vessel, and e. Allowing the cells to grow in said medium for at least about five days, thereby obtaining a population of amniotic fluid-derived cells. [16] 19. The method according to claim 18, wherein the cells of said population are substantially negative in the expression of at least one protein marker selected from the group consisting of: CD117, Oct-4, and Tra2-54. The method according to claim 19, wherein the cells of said population are substantially positive for the expression of at least one protein marker selected from the group consisting of: HNF-1 beta, GATA-6, and Sox-17. [17] 21. The method according to claim 19, wherein the cells of said population also express at least one gene selected from the group consisting of: HNF-3 beta, Hes-1, GATA-4 and Musashi-1. [18] 22. The method according to claim 19, wherein the cells of said population are positive for the expression of at least one protein marker selected from the group consisting of: Liver Activator Protein, PDGF receptor 3, AXL, bFGF, EGF receptor, Fas /TNFRSF6, GRO, GRO-alpha, ICAM-1, IL-lalpha, 11-3, Il- 6, 11-8, MIF, Osteoprotegerin, TIMP-2, and TRAIL R3. [19] 23. The method according to claim 19, wherein the cells of said population are substantially negative in the expression of the protein marker Sox-17. 24/05/06,15735 speci gp, 4 3 9 -440- O 24. The method according to claim 23, wherein the cells of said population are Ssubstantially negative in the expression of cytokeratin protein. The method according to claim 23, wherein the cells of said population are positive for the expression of at least one protein marker selected from the N 5 group consisting of: Liver Activator Protein, PDGF receptor 0, bFGF, EGF receptor, GRO, GRO-alpha, ICAM-1, 11-3, 11-6, MIF, Osteoprotegerin, TIMP- S2, and TRAIL R3. S26. The method according to claim 18, wherein the cells of said population are substantially negative in the expression of the protein marker Sox-17, and also O express at least one gene selected from the group consisting of: Hes-1 and Musashi-1. [20] 27. The method according to claim 18, wherein the cells of said population are substantially negative in the expression of CD117, Oct-4, Sox-17, and Tra2-54. [21] 28. The method according to claim 27, wherein the cells of said population are substantially negative in the expression of cytokeratin protein. [22] 29. The method according to claim 27, wherein the cells of said population are positive for the expression of at least one protein marker selected from the group consisting of: Liver Activator Protein, PDGF receptor P, bFGF, EGF receptor, GRO, GRO-alpha, ICAM-1, 11-3, 11-6, MIF, Osteoprotegerin, TIMP- 2, and TRAIL R3. The method according to claim 27, wherein the cells of said population are substantially negative in the expression of the protein marker Sox-17, and also express at least one gene selected from the group consisting of: Hes-1 and Musashi-1. [23] 31. The method according to claim 18, wherein the cells of said population are capable of propagating in vitro. [24] 32. The method according to claim 18, wherein the cells of said population are capable of propagating in vitro under hypoxic conditions. 24/05/06,15735 speci gp.440 -441- [25] 33. The method according to claim 18, wherein the cells of said population are capable of differentiating into cells displaying the characteristics of the 3-cell lineage. [26] 34. The method according to claim 18, wherein the cells of said population are capable of differentiating into a gut hormone-producing cell. A method of obtaining a population of cells from amniotic fluid, comprising: a. Isolating amniotic fluid, b. Isolating the cells from the amniotic fluid, c. Selecting cells that express at least one of the markers selected from the group consisting of SSEA-4, SSEA-3, TRA 1-60 and TRA 1-81, d. Placing the cells in culture medium, e. Plating the cells in a culture vessel, and f. Allowing the cells to grow in said medium for at least about five days, thereby obtaining a population of amniotic fluid-derived cells. [27] 36. The method according to claim 35, wherein the cells of said population are substantially negative in the expression of at least one protein marker selected from the group consisting of: CD117, Oct-4, and Tra2-54. [28] 37. The method according to claim 36, wherein the cells of said population are substantially positive for the expression of at least one protein marker selected from the group consisting of: HNF-1 beta, GATA-6, and Sox-17. [29] 38. The method according to claim 36, wherein the cells of said population also express at least one gene selected from the group consisting of: HNF-3 beta, Hes-1, GATA-4 and Musashi-1. [30] 39. The method according to claim 36, wherein the cells of said population are positive for the expression of at least one protein marker selected from the group consisting of: Liver Activator Protein, PDGF receptor P, AXL, bFGF, 24f05/06, 15735 speci gp,441 -442- EGF receptor, Fas /TNFRSF6, GRO, GRO-alpha, ICAM-1, IL-lalpha, 11-3, Il- 6, 11-8, MIF, Osteoprotegerin, TIMP-2, and TRAIL R3. The method according to claim 36, wherein the cells of said population are substantially negative in the expression of the protein marker Sox-17. [31] 41. The method according to claim 40, wherein the cells of said population are substantially negative in the expression of cytokeratin protein. [32] 42. The method according to claim 40, wherein the cells of said population are positive for the expression of at least one protein marker selected from the group consisting of: Liver Activator Protein, PDGF receptor 3, bFGF, EGF receptor, GRO, GRO-alpha, ICAM-1, 11-3, 11-6, MIF, Osteoprotegerin, TIMP- 2, and TRAIL R3. [33] 43. The method according to claim 35, wherein the cells of said population are substantially negative in the expression of the protein marker Sox-17, and also express at least one gene selected from the group consisting of: Hes-1 and Musashi-1. [34] 44. The method according to claim 40, wherein the cells of said population are substantially negative in the expression of CD 17, Oct-4, Sox-17, and Tra2-54. The method according to claim 44, wherein the cells of said population are substantially negative in the expression of cytokeratin protein. [35] 46. The method according to claim 44, wherein the cells of said population are positive for the expression of at least one protein marker selected from the group consisting of: Liver Activator Protein, PDGF receptor P, bFGF, EGF receptor, GRO, GRO-alpha, ICAM-1, 11-3, 11-6, MIF, Osteoprotegerin, TIMP- 2, and TRAIL R3. [36] 47. The method according to claim 44, wherein the cells of said population are substantially negative in the expression of the protein marker Sox-17, and also express at least one gene selected from the group consisting of: Hes-1 and Musashi-1. 24/05/06,15735 speci gp, 4 4 2 -443- S48. The method according to claim 35, wherein the cells of said population are Scapable of propagating in vitro. [37] 49. The method according to claim 35, wherein the cells of said population are capable of propagating in vitro under hypoxic conditions. Ni [38] 50. The method according to claim 35, wherein the cells of said population are capable of differentiating into cells displaying the characteristics of the 1-cell lineage. N< 51. The method according to claim 35, wherein the cells of said population are capable of differentiating into a gut hormone-producing cell. [39] 52. A method of treating a patient with diabetes mellitus or at risk of developing diabetes, comprising: a. Isolating a population of amniotic fluid-derived cells from a donor, and b. Transferring the cells into the patient. [40] 53. The method according to claim 52, wherein the cells of said population are substantially negative in the expression of at least one protein marker selected from the group consisting of: CD117, Oct-4, and Tra2-54. [41] 54. The method according to claim 53, wherein the cells of said population are substantially positive for the expression of at least one protein marker selected from the group consisting of: HNF-1 beta, GATA-6, and Sox-17. The method according to claim 53, wherein the cells of said population also express at least one gene selected from the group consisting of: HNF-3 beta, Hes-1, GATA-4 and Musashi-1. [42] 56. The method according to claim 53, wherein the cells of said population are positive for the expression of at least one protein marker selected from the group consisting of: Liver Activator Protein, PDGF receptor 3, AXL, bFGF, 24/05/06.15735 speci gp.443 -444- EGF receptor, Fas /TNFRSF6, GRO, GRO-alpha, ICAM-1, IL-lalpha, 11-3, I1- 6, 11-8, MIF, Osteoprotegerin, TIMP-2, and TRAIL R3. [43] 57. The method according to claim 53, wherein the cells of said population are substantially negative in the expression of the protein marker Sox-17. [44] 58. The method according to claim 57, wherein the cells of said population are substantially negative in the expression of cytokeratin protein. [45] 59. The method according to claim 57, wherein the cells of said population are positive for the expression of at least one protein marker selected from the group consisting of: Liver Activator Protein, PDGF receptor p, bFGF, EGF receptor, GRO, GRO-alpha, ICAM-1, 11-3, 11-6, MIF, Osteoprotegerin, TIMP- 2, and TRAIL R3. The method according to claim 52, wherein the cells of said population are substantially negative in the expression of the protein marker Sox-17, and also express at least one gene selected from the group consisting of: Hes-1 and Musashi-1. [46] 61. The method according to claim 57, wherein the cells of said population are substantially negative in the expression of CD 117, Oct-4, Sox-17, and Tra2-54. [47] 62. The method according to claim 61, wherein the cells of said population are substantially negative in the expression of cytokeratin protein. [48] 63. The method according to claim 61, wherein the cells of said population are positive for the expression of at least one protein marker selected from the group consisting of: Liver Activator Protein, PDGF receptor P, bFGF, EGF receptor, GRO, GRO-alpha, ICAM-1, 11-3, 11-6, MIF, Osteoprotegerin, TIMP- 2, and TRAIL R3. [49] 64. The method according to claim 61, wherein the cells of said population are substantially negative in the expression of the protein marker Sox-17, and also express at least one gene selected from the group consisting of: Hes-1 and Musashi-1. 24/05/06,15735 speci gp,4 4 4 -445- The method according to claim 52, wherein the cells of said population are differentiated into pancreatic hormone producing cells prior to the step of transferring into the patient. [50] 66. The method according to claim 52, wherein the cells of said population differentiate into pancreatic hormone producing cells after the step of transferring into the patient. [51] 67. The method according to claim 52, wherein the cells of said population are capable of propagating in vitro. [52] 68. The method according to claim 52, wherein the cells of said population are capable of propagating in vitro under hypoxic conditions. [53] 69. The method according to claim 52, wherein the cells of said population are capable of differentiating into cells displaying the characteristics of the 3-cell lineage. The method according to claim 52, wherein the cells of said population are capable of differentiating into a gut hormone-producing cell. [54] 71. A substantially pure population of amniotis fluid-dervice cells, substantially as hereinbefore described with reference to the accompanying drawings or any one of the specific examples. [55] 72. A method of obtaining a population of cells from amniotic fluid, substantially as hereinbefore described with reference to the accompanying drawings or any one of the specific examples. DATED this 25th day of May 2006 APPLICANT By their Patent Attorneys Callinan Lawrie 25/05/06,15735 speci gp, 44
类似技术:
公开号 | 公开日 | 专利标题 EP1780267B1|2016-01-13|Amniotic fluid derived cells US20150050728A1|2015-02-19|Identification Of Novel Cell Surface Markers For Pancreatic Progenitor Cells And Definite Endodermal Cells EP3327114B1|2019-11-06|Pluripotent cells US20100166713A1|2010-07-01|Early mesoderm cells, a stable population of mesendoderm cells that has utility for generation of endoderm and mesoderm lineages and multipotent migratory cells | ES2627419T3|2017-07-28|Adult stromal cells derived from the pancreas Gotherstrom et al.2005|Difference in gene expression between human fetal liver and adult bone marrow mesenchymal stem cells Zeng et al.2004|Properties of pluripotent human embryonic stem cells BG01 and BG02 US20150197725A1|2015-07-16|Method of Deriving Mesenchymal Stem Cells US10612094B2|2020-04-07|Genetic markers for engraftment of human cardiac ventricular progenitor cells US20070287176A1|2007-12-13|Chorionic villus derived cells Chen et al.2009|Novel autogenic feeders derived from human embryonic stem cells | support an undifferentiated status of hESCs in xeno-free culture conditions Kim et al.2006|Profiling of differentially expressed genes in human stem cells by cDNA microarray. Piravar et al.2013|In vitro culture of human testicular stem cells on feeder-free condition Shiraki et al.2010|Identification of DAF1/CD55, a novel definitive endoderm marker CN113767167A|2021-12-07|In vivo generation of functional and patient-specific thymus tissue from induced pluripotent stem cells WO2008153568A1|2008-12-18|Chorionic villus derived cells US11060062B2|2021-07-13|Generation of glucose-responsive beta cells US20190127687A1|2019-05-02|Methods of expanding human prepubertal spermatogonial stem cells IL288301D0|2022-01-01|Methods of culturing human pluripotent cells WO2011106676A2|2011-09-01|Methods of human embryonic stem cell growth Song et al.0|Stem Cell Genetics AND Genomics
同族专利:
公开号 | 公开日 CA2547845C|2016-02-09| SI1780267T1|2016-03-31| EP1780267A3|2007-08-01| HK1104059A1|2008-01-04| US20070122903A1|2007-05-31| EP2302036A2|2011-03-30| ES2569421T3|2016-05-10| CY1117721T1|2017-05-17| CA2547845A1|2006-11-27| PL1780267T3|2016-07-29| HUE028239T2|2016-12-28| EP1780267B1|2016-01-13| DK1780267T3|2016-01-25| AU2006202209B2|2011-04-14| JP2006325594A|2006-12-07| EP1780267A2|2007-05-02| EP2302036A3|2011-06-15|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题 US2324800A|1941-08-14|1943-07-20|Pfizer Charles & Co|Purification of riboflavin| US2864848A|1954-07-19|1958-12-16|Ca Nat Research Council|Method of producing l-alpha-glycerylphosphorylcholine| US2912332A|1958-02-27|1959-11-10|Swift & Co|Stabilized thiamine composition and method of enriching food products| US3209652A|1961-03-30|1965-10-05|Burgsmueller Karl|Thread whirling method| AT326803B|1968-08-26|1975-12-29|Binder Fa G|MESHWARE AND METHOD OF MANUFACTURING THE SAME| US3935067A|1974-11-22|1976-01-27|Wyo-Ben Products, Inc.|Inorganic support for culture media| US4216144A|1977-10-20|1980-08-05|Ashmead H H|Soluble iron proteinates| US4393240A|1981-07-06|1983-07-12|Stille John K|Optically active phosphines| US4465776A|1982-09-27|1984-08-14|Research Corporation|Monoclonal antibodies to vitamin B6 and immunoassay method| US4499802A|1982-09-29|1985-02-19|Container Graphics Corporation|Rotary cutting die with scrap ejection| US4533634A|1983-01-26|1985-08-06|Amf Inc.|Tissue culture medium| US4537773A|1983-12-05|1985-08-27|E. I. Du Pont De Nemours And Company|α-Aminoboronic acid derivatives| US4557264A|1984-04-09|1985-12-10|Ethicon Inc.|Surgical filament from polypropylene blended with polyethylene| US5089396A|1985-10-03|1992-02-18|Genentech, Inc.|Nucleic acid encoding β chain prodomains of inhibin and method for synthesizing polypeptides using such nucleic acid| US5215893A|1985-10-03|1993-06-01|Genentech, Inc.|Nucleic acid encoding the ba chain prodomains of inhibin and method for synthesizing polypeptides using such nucleic acid| US4737578A|1986-02-10|1988-04-12|The Salk Institute For Biological Studies|Human inhibin| US5863531A|1986-04-18|1999-01-26|Advanced Tissue Sciences, Inc.|In vitro preparation of tubular tissue structures by stromal cell culture on a three-dimensional framework| CA1340581C|1986-11-20|1999-06-08|Joseph P. Vacanti|Chimeric neomorphogenesis of organs by controlled cellular implantation using artificial matrices| US5567612A|1986-11-20|1996-10-22|Massachusetts Institute Of Technology|Genitourinary cell-matrix structure for implantation into a human and a method of making| US5804178A|1986-11-20|1998-09-08|Massachusetts Institute Of Technology|Implantation of cell-matrix structure adjacent mesentery, omentum or peritoneum tissue| EP0363125A3|1988-10-03|1990-08-16|Hana Biologics Inc.|Proliferated pancreatic endocrine cell product and process| US4994602A|1989-02-27|1991-02-19|Takasago International Corporation|Process for preparing optically active 6-t-butyoxy-3,5-dihydroxyhexanoic esters| US5837539A|1990-11-16|1998-11-17|Osiris Therapeutics, Inc.|Monoclonal antibodies for human mesenchymal stem cells| US5449383A|1992-03-18|1995-09-12|Chatelier; Ronald C.|Cell growth substrates| GB9206861D0|1992-03-28|1992-05-13|Univ Manchester|Wound healing and treatment of fibrotic disorders| CA2114282A1|1993-01-28|1994-07-29|Lothar Schilder|Multi-layered implant| US5523226A|1993-05-14|1996-06-04|Biotechnology Research And Development Corp.|Transgenic swine compositions and methods| GB9310557D0|1993-05-21|1993-07-07|Smithkline Beecham Plc|Novel process and apparatus| TW257671B|1993-11-19|1995-09-21|Ciba Geigy|| US6001647A|1994-04-28|1999-12-14|Ixion Biotechnology, Inc.|In vitro growth of functional islets of Langerhans and in vivo uses thereof| US5834308A|1994-04-28|1998-11-10|University Of Florida Research Foundation, Inc.|In vitro growth of functional islets of Langerhans| US6703017B1|1994-04-28|2004-03-09|Ixion Biotechnology, Inc.|Reversal of insulin-dependent diabetes by islet-producing stem cells, islet progenitor cells and islet-like structures| US6083903A|1994-10-28|2000-07-04|Leukosite, Inc.|Boronic ester and acid compounds, synthesis and uses| US5843780A|1995-01-20|1998-12-01|Wisconsin Alumni Research Foundation|Primate embryonic stem cells| US5718922A|1995-05-31|1998-02-17|Schepens Eye Research Institute, Inc.|Intravitreal microsphere drug delivery and method of preparation| US5908782A|1995-06-05|1999-06-01|Osiris Therapeutics, Inc.|Chemically defined medium for human mesenchymal stem cells| WO1999001145A1|1997-07-03|1999-01-14|Osiris Therapeutics, Inc.|Human mesenchymal stem cells from peripheral blood| DK1015576T3|1997-09-16|2005-08-29|Egea Biosciences Llc|Method for complete chemical synthesis and aggregation of genes and genomes| US6670127B2|1997-09-16|2003-12-30|Egea Biosciences, Inc.|Method for assembly of a polynucleotide encoding a target polypeptide| EP1025204A4|1997-10-23|2001-02-28|Geron Corp|Methods and materials for the growth of primate-derived primordial stem cells| ZA9811898B|1997-12-29|2000-06-28|Ortho Mcneil Pharm Inc|Anti-Inflammatory Compounds.| AT316795T|1998-03-18|2006-02-15|Osiris Therapeutics Inc|MESENCHYMAL STEM CELLS FOR THE PREVENTION AND TREATMENT OF IMMUNE RESPONSES IN TRANSPLANTATIONS| MY132496A|1998-05-11|2007-10-31|Vertex Pharma|Inhibitors of p38| US6413556B1|1999-01-08|2002-07-02|Sky High, Llc|Aqueous anti-apoptotic compositions| US6458593B1|1999-01-21|2002-10-01|Vitro Diagnostics, Inc.|Immortalized cell lines and methods of making the same| US6261600B1|1999-04-30|2001-07-17|Drugtech Corporation|Folic acid supplement| US6492169B1|1999-05-18|2002-12-10|Crucell Holland, B.V.|Complementing cell lines| US6815203B1|1999-06-23|2004-11-09|Joslin Diabetes Center, Inc.|Methods of making pancreatic islet cells| US6306424B1|1999-06-30|2001-10-23|Ethicon, Inc.|Foam composite for the repair or regeneration of tissue| US6333029B1|1999-06-30|2001-12-25|Ethicon, Inc.|Porous tissue scaffoldings for the repair of regeneration of tissue| US6685936B2|1999-10-12|2004-02-03|Osiris Therapeutics, Inc.|Suppressor cells induced by culture with mesenchymal stem cells for treatment of immune responses in transplantation| US20030082155A1|1999-12-06|2003-05-01|Habener Joel F.|Stem cells of the islets of langerhans and their use in treating diabetes mellitus| WO2001042789A1|1999-12-13|2001-06-14|The Scripps Research Institute|MARKERS FOR IDENTIFICATION AND ISOLATION OF PANCREATIC ISLET α AND β CELL PROGENITORS| US6667176B1|2000-01-11|2003-12-23|Geron Corporation|cDNA libraries reflecting gene expression during growth and differentiation of human pluripotent stem cells| US7005252B1|2000-03-09|2006-02-28|Wisconsin Alumni Research Foundation|Serum free cultivation of primate embryonic stem cells| US6436704B1|2000-04-10|2002-08-20|Raven Biotechnologies, Inc.|Human pancreatic epithelial progenitor cells and methods of isolation and use thereof| US6458589B1|2000-04-27|2002-10-01|Geron Corporation|Hepatocyte lineage cells derived from pluripotent stem cells| CN1449439A|2000-06-26|2003-10-15|株式会社雷诺再生医学研究所|Cell fraction containing cells capable of differentiating into nervous system cells| CZ20031125A3|2000-10-23|2003-10-15|Smithkline Beecham Corporation|Novel compounds| US6599323B2|2000-12-21|2003-07-29|Ethicon, Inc.|Reinforced tissue implants and methods of manufacture and use| JP2005503759A|2001-01-24|2005-02-10|アメリカ合衆国|Differentiation of stem cells into pancreatic endocrine cells| WO2002059130A1|2001-01-25|2002-08-01|The United States Of America, Represented By The Secretary, Department Of Health And Human Services|Formulation of boronic acid compounds| US6656488B2|2001-04-11|2003-12-02|Ethicon Endo-Surgery, Inc.|Bioabsorbable bag containing bioabsorbable materials of different bioabsorption rates for tissue engineering| JP2004527249A|2001-04-19|2004-09-09|デヴェロゲンアクチエンゲゼルシャフトフュアエントヴィックルングスビオローギッシェフォルシュング|Method of differentiating stem cells into insulin producing cells| EP1391505B1|2001-04-24|2009-01-28|Ajinomoto Co., Inc.|Stem cells and method of separating the same| CA2447015A1|2001-05-15|2002-11-21|Rappaport Family Institute For Research In The Medical Sciences|Insulin producing cells derived from human embryonic stem cells| US6626950B2|2001-06-28|2003-09-30|Ethicon, Inc.|Composite scaffold with post anchor for the repair and regeneration of tissue| GB0117583D0|2001-07-19|2001-09-12|Astrazeneca Ab|Novel compounds| WO2003014313A2|2001-08-06|2003-02-20|Bresagen, Ltd.|Alternative compositions and methods for the culture of stem cells| US6617152B2|2001-09-04|2003-09-09|Corning Inc|Method for creating a cell growth surface on a polymeric substrate| JP2005506074A|2001-10-18|2005-03-03|イクシオン・バイオテクノロジー・インコーポレーテッド|Conversion of hepatic stem and progenitor cells into functional pancreatic cells| WO2003042405A2|2001-11-15|2003-05-22|Children's Medical Center Corporation|Methods of isolation, expansion and differentiation of fetal stem cells from chorionic villus, amniotic fluid, and placenta and therapeutic uses thereof| CN1630526B|2001-12-07|2010-05-05|马克罗珀尔生物外科公司|Systems and methods for treating patients with processed lipoaspirate cells| EP1463798A4|2001-12-07|2005-01-19|Geron Corp|Islet cells from human embryonic stem cells| US20030158089A1|2002-01-24|2003-08-21|Xenoport, Inc.|Administrative agents via the SMVT transporter| US20030162290A1|2002-01-25|2003-08-28|Kazutomo Inoue|Method for inducing differentiation of embryonic stem cells into functioning cells| US20030180268A1|2002-02-05|2003-09-25|Anthony Atala|Tissue engineered construct for supplementing or replacing a damaged organ| WO2003087349A1|2002-04-17|2003-10-23|Otsuka Pharmaceutical Co., Ltd.|METHOD OF FORMING PANCREATIC β CELLS FROM MESENCHYMAL CELLS| US20040161419A1|2002-04-19|2004-08-19|Strom Stephen C.|Placental stem cells and uses thereof| US20060122104A1|2002-05-28|2006-06-08|Presnell Sharon C|Methods for in vitro expansion and transdifferentiation of human pancreatic acinar cells into insulin-producing cells| US6877147B2|2002-07-22|2005-04-05|Broadcom Corporation|Technique to assess timing delay by use of layout quality analyzer comparison| US7838290B2|2002-07-25|2010-11-23|The Scripps Research Institute|Hematopoietic stem cells and methods of treatment of neovascular eye diseases therewith| EP1539930A4|2002-07-29|2006-08-09|Es Cell Int Pte Ltd|Multi-step method for the differentiation of insulin positive, glucose| US9969977B2|2002-09-20|2018-05-15|Garnet Biotherapeutics|Cell populations which co-express CD49c and CD90| US20040062753A1|2002-09-27|2004-04-01|Alireza Rezania|Composite scaffolds seeded with mammalian cells| US7144999B2|2002-11-23|2006-12-05|Isis Pharmaceuticals, Inc.|Modulation of hypoxia-inducible factor 1 alpha expression| US7521481B2|2003-02-27|2009-04-21|Mclaurin Joanne|Methods of preventing, treating and diagnosing disorders of protein aggregation| US20070020242A1|2003-03-27|2007-01-25|Ixion Biotechnology, Inc.|Method for transdifferentiation of non-pancreatic stem cells to the pancreatic pathway| ES2554343T3|2003-06-27|2015-12-18|DePuy Synthes Products, Inc.|Postpartum cells derived from umbilical cord tissue and methods of preparing and using them| WO2005017117A2|2003-08-14|2005-02-24|Martin Haas|Multipotent amniotic fetal stem cells and banking of same| CA2550010A1|2003-12-17|2005-06-30|Allergan, Inc.|Methods for treating retinoid responsive disorders using selective inhibitors of cyp26a and cyp26b| US20050233446A1|2003-12-31|2005-10-20|Parsons Xuejun H|Defined media for stem cell culture| TWI334443B|2003-12-31|2010-12-11|Ind Tech Res Inst|Method of single cell culture of undifferentiated human embryonic stem cells| US7655678B2|2004-11-30|2010-02-02|Council of Scientfic & Industrial Research|Pharmaceutical composition for the management of tumors| US7939645B2|2006-01-06|2011-05-10|Agilent Technologies, Inc|Reaction buffer composition for nucleic acid replication with packed DNA polymerases| WO2009086215A2|2007-12-21|2009-07-09|Wyeth|Pathway analysis of cell culture phenotypes and uses thereof|US8057788B2|2000-12-06|2011-11-15|Anthrogenesis Corporation|Placental stem cell populations| KR101378874B1|2005-10-13|2014-03-27|안트로제네시스 코포레이션|Immunomodulation using placental stem cells| PL2046946T3|2006-06-26|2017-04-28|Lifescan, Inc.|Pluripotent stem cell culture| US7993918B2|2006-08-04|2011-08-09|Anthrogenesis Corporation|Tumor suppression using placental stem cells| US8372437B2|2006-08-17|2013-02-12|Mimedx Group, Inc.|Placental tissue grafts| EP2420568A3|2006-10-23|2015-09-30|Anthrogenesis Corporation|Methods and compositions for treatment of bone defects with placental cell populations| EP2687220A3|2007-02-12|2014-05-14|Anthrogenesis Corporation|Treatment of inflammatory diseases using placental stem cells| AR065584A1|2007-03-01|2009-06-17|Cryo Cell Internat Inc|OBTAINING INSULATION AND CRIOCONSERVATION OF ENDOMETRIC / MENSTRUAL CELL| US9080145B2|2007-07-01|2015-07-14|Lifescan Corporation|Single pluripotent stem cell culture| CA3114827A1|2007-07-31|2009-02-05|Lifescan, Inc.|Differentiation of human embryonic stem cells to pancreatic endocrine| KR101648589B1|2007-09-28|2016-08-17|안트로제네시스 코포레이션|Tumor suppression using human placental perfusate and human placenta-derived intermediate natural killer cells| WO2009105570A2|2008-02-21|2009-08-27|Centocor Ortho Biotech Inc.|Methods, surface modified plates and compositions for cell attachment, cultivation and detachment| KR101734501B1|2008-06-30|2017-05-11|얀센 바이오테크 인코포레이티드|Differentiation of pluripotent stem cells| KR20110050521A|2008-08-20|2011-05-13|안트로제네시스 코포레이션|Improved cell composition and methods of making the same| CN102176919A|2008-08-22|2011-09-07|人类起源公司|Methods and compositions for treatment of bone defects with placental cell populations| ES2749500T3|2008-11-19|2020-03-20|Celularity Inc|Adherent cells derived from amnion| US20100124781A1|2008-11-20|2010-05-20|Shelley Nelson|Pluripotent Stem Cell Culture on Micro-Carriers| US9969973B2|2008-11-20|2018-05-15|Janssen Biotech, Inc.|Methods and compositions for cell attachment and cultivation on planar substrates| AU2010211428B2|2009-02-03|2015-09-03|Koninklijke Nederlandse Akademie Van Wetenschappen|Culture medium for epithelial stem cells and organoids comprising said stem cells.| US9752124B2|2009-02-03|2017-09-05|Koninklijke Nederlandse Akademie Van Wetenschappen|Culture medium for epithelial stem cells and organoids comprising the stem cells| KR102058901B1|2009-07-20|2019-12-24|얀센 바이오테크 인코포레이티드|Differentiation of human embryonic stem cells| EP2516625A4|2009-12-23|2013-07-31|Janssen Biotech Inc|Differentiation of human embryonic stem cells| MX2012008636A|2010-01-26|2012-10-15|Anthrogenesis Corp|Treatment of bone-related cancers using placental stem cells.| KR20130025375A|2010-03-01|2013-03-11|얀센 바이오테크 인코포레이티드|Methods for purifying cells derived from pluripotent stem cells| TW201902496A|2010-04-07|2019-01-16|美商安瑟吉納西斯公司|Using angiogenesis of placental stem cells| KR20130092394A|2010-04-08|2013-08-20|안트로제네시스 코포레이션|Treatment of sarcoidosis using placental stem cells| JP5996533B2|2010-07-13|2016-09-21|アントフロゲネシス コーポレーション|How to generate natural killer cells| IT1405069B1|2010-07-27|2013-12-16|Uni Degli Studi Perugia|INSULATION OF STEM CELLS MULTI-FULLY FROM AMNIOTIC LIQUID AND THEIR USE IN THE TREATMENT OR PREVENTION OF AUTOIMMUNE DISEASES.| EP2412800A1|2010-07-29|2012-02-01|Koninklijke Nederlandse Akademie van Wetenschappen|Liver organoid, uses thereof and culture method for obtaining them| ES2660897T3|2010-08-31|2018-03-26|Janssen Biotech, Inc.|Differentiation of human embryonic stem cells| CN104204190B|2010-10-18|2017-02-01|尚翔股份有限公司|Human multipotent embryonic stem cell-like progenitor cells| AU2011352036A1|2010-12-31|2013-07-18|Anthrogenesis Corporation|Enhancement of placental stem cell potency using modulatory RNA molecules| EP2714059B1|2011-06-01|2018-10-03|Celularity, Inc.|Treatment of pain using placental stem cells| RU2705001C2|2011-12-22|2019-11-01|Янссен Байотек, Инк.|Differentiation of human embryonic stem cells into single-hormonal insulin-positive cells| ES2690118T3|2012-06-08|2018-11-19|Janssen Biotech, Inc.|Differentiation of human embryonic stem cells in pancreatic endocrine cells| MX2015008577A|2012-12-31|2015-09-07|Janssen Biotech Inc|Culturing of human embryonic stem cells at the air-liquid interface for differentiation into pancreatic endocrine cells.| US10138465B2|2012-12-31|2018-11-27|Janssen Biotech, Inc.|Differentiation of human embryonic stem cells into pancreatic endocrine cells using HB9 regulators| RU2018108090A|2012-12-31|2019-02-25|Янссен Байотек, Инк.|SUSPENDING AND CLUSTERING OF HUMAN PLURIPOTENT CELLS FOR THEIR DIFFERENTIATION IN PANCREATIC ENDOCRINE CELLS| US10370644B2|2012-12-31|2019-08-06|Janssen Biotech, Inc.|Method for making human pluripotent suspension cultures and cells derived therefrom| CN103937871B|2013-01-23|2019-07-23|上海市东方医院|The application of SRRP35 gene and expression product in cancer diagnosis and treatment| EP2953635A4|2013-02-05|2016-10-26|Anthrogenesis Corp|Natural killer cells from placenta| US10500231B2|2013-03-13|2019-12-10|University Of Miami|Method for isolation and purification of microvesicles from cell culture supernatants and biological fluids| US9700585B2|2013-09-26|2017-07-11|NuTech Medical, Inc.|Multipotent prenatal stem cells| DK3143127T3|2014-05-16|2021-09-13|Janssen Biotech Inc|USE OF SMALL MOLECULES TO ENHANGE MAFA EXPRESSION IN ENDOCRINE PANCREAS CELLS| EP3143126A1|2014-05-16|2017-03-22|Koninklijke Nederlandse Akademie van Wetenschappen|Improved culture method for organoids| SG11201703305SA|2014-10-24|2017-05-30|Sumitomo Dainippon Pharma Co Ltd|Production method for nerve tissue| GB201421092D0|2014-11-27|2015-01-14|Koninklijke Nederlandse Akademie Van Wetenschappen|Culture medium| GB201421094D0|2014-11-27|2015-01-14|Koninklijke Nederlandse Akademie Van Wetenschappen|Culture medium| US10772917B2|2015-03-11|2020-09-15|Ccs Ventures Limited|Pancreatic endocrine progenitor cell therapies for the treatment of obesity and type 2 diabetes | MA45479A|2016-04-14|2019-02-20|Janssen Biotech Inc|DIFFERENTIATION OF PLURIPOTENT STEM CELLS IN ENDODERMAL CELLS OF MIDDLE INTESTINE| EP3447129A4|2016-04-22|2019-10-30|Sumitomo Dainippon Pharma Co., Ltd.|Method for producing retinal tissue| MA45502A|2016-06-21|2019-04-24|Janssen Biotech Inc|GENERATION OF FUNCTIONAL BETA CELLS DERIVED FROM HUMAN PLURIPOTENT STEM CELLS WITH GLUCOSE-DEPENDENT MITOCHONDRIAL RESPIRATION AND TWO-PHASE INSULIN SECRETION RESPONSE| US10767164B2|2017-03-30|2020-09-08|The Research Foundation For The State University Of New York|Microenvironments for self-assembly of islet organoids from stem cells differentiation| WO2021076042A2|2019-10-18|2021-04-22|Amniotics Ab|Processes and apparatuses for obtaining amniotic mesenchymal stem cells from amniotic fluid and cells derived thereof| WO2022040516A1|2020-08-21|2022-02-24|University Of Miami|Compositions and methods of treatment using microvesicles from bone marrow-derived mesenchymal stem cells|
法律状态:
2011-08-11| FGA| Letters patent sealed or granted (standard patent)| 2019-12-19| MK14| Patent ceased section 143(a) (annual fees not paid) or expired|
优先权:
[返回顶部]
申请号 | 申请日 | 专利标题 US68560705P| true| 2005-05-27|2005-05-27|| US60/685,607||2005-05-27|| US74382106P| true| 2006-03-27|2006-03-27|| US60/743,821||2006-03-27|| 相关专利
Sulfonates, polymers, resist compositions and patterning process
Washing machine
Washing machine
Device for fixture finishing and tension adjusting of membrane
Structure for Equipping Band in a Plane Cathode Ray Tube
Process for preparation of 7 alpha-carboxyl 9, 11-epoxy steroids and intermediates useful therein an
|